It's kind of surreal watching you talk about that while you basically spit in the faces of people working on string theory. Is it just that you understand the future application better or do you just see genetics as figuring out how it works while viewing the string theory stuff as figuring out if it's right or wrong?

Right now we're learning to read (and seeing how things change when we mix parts of two books, so to speak,) but once we start composing that stuff will be important. For now modifying humans is rather lofty and distant.

Well with as much as I've been using the term naturalism I think there could be some dangerous confusion in bringing this up but...
well "natural" doesn't mean "good." People argue against things as "unnatural" far too often when that doesn't really have anything to do with the qualities of it.

You'd never eat any of the things we do "naturally..." Most of them didn't exist like they do now before we altered them, and I don't mean with genetic engineering. We've already done so much more.

Well when we know the sequence we can "remove" things from the genepool without "losing" them. It's kind of troublesome to build custom sequences of DNA right now but once you've got one strand of it it's easy to make lots.

I think as we get to growing organs we'd be safe and able to undo any mistakes that allowed people to grow mostly normal but with some big problem that came along. In the hard statistics of genetics that could still mean millions dieing but as far as humanity sticking around we could cling on long enough to get over anything we could have "naturally" survived.

You could still advocate the cause. I'd really suggest learning the formal debate stuff (visit that http://www.goodart.org/fallazoo.htm site for starters,) before you go trying to sway opinion one way or the other in public topics. People are quick to label the side that looks like it uses more fallacies as, well, basically a bunch of deceptive liars who are just fighting for their personal interests.

Well the viral DNA that "breaks" it's sequence and just sits around as junk is handy some of the time as you've now got the code for several molecules that already have functions sitting in the DNA. If you alter the promoter or similar parts you can throw them into different contexts where they might be immediately useful and if not small alterations can likely get other types that could be useful in some cellular process and you didn't have to wait for them to pop up from scratch.

Well, that doesn't really happen. The thousand year timescale for that is no good for individuals trying to compete against their neighbors. It's more like you don't have to duplicate one of your genes and risk it recombining later and chopping out parts.

Was it you or sky that was asking for some evidence of "failed universes"?

Basically because we can go ahead and complicate up an idea endlessly to explain anything. We used to say that you got sick because of demons and even today there are some people that think prayer will make you better. Turns out if the sincerely pray to a jar of pickles you have your prayers answered just as often so that either makes the jar of pickles a god, the act of prayer have no impact, the act of prayer not matter where it is aimed, or you've got some kind of wizard confusing the whole business. (I think with a broad interpretation I actually covered all the possibilities there.)

For anyone not already inclined to believe the default of those is that prayer doesn't do anything, or if you've got some information showing otherwise the default switches to prayer's effect not being impacted by what is being prayed to. This is how we think now and it's led us to much better behaviors than what we used to do to try and get the demons out.

Now if you mix the modern "we're going to check to see if things actually work" with belief that it's really demons behind it fine. There's no real travesty that will come from that but it's philosophically weak because you're taking someone else's work and using some white out to stick your source of the phenomenon into the mix without really adding anything. The real strength of these things are saying "I think this is the source and if it is that would mean it works like this and this and this" and then having someone come along and actually show that it works that way; the act of predicting things we didn't know is immensely powerful.

If you went to making predictions you'd definitely be at risk of having them shown to be wrong and you would then have to abandon the idea but if you were right...

Well, taking the current and saying it could only come from a creator is safe (especially the way you've got the creator laying out in the undetermined area where as we discover new places it isn't you can just say it's still further out,) so if safe is what you want so be it.

Something that doesn't explain anything. Of course, that's a moot point because strings actually explain quite a bit. At a high school level of detail you'll never know what it explains or why but the professionals aren't putting all their energy into a meaningless smooge. If we work it all out a decade or two later the common high school stuff will give you some vague details on it but it will probably mislead people just as much as high school big bang explanations (if you hadn't been on forums and/or taught it yourself but actually knew the details of big bang you'd never believe how many people think it says some kind of atom exploded."

That's really only because you haven't said what a pink elephantic smooge is. All words are meaningless if undefined. Point to a hypothetical thing that it is and describe why you'd want to use that as an explanation and you'll be off to a decent start.

btw, I'm probably going to borrow "pink elephantic smooge" if I find that you actually made it up on the spot here like I think.

Our design seems rather unintelligent. Even the oxygen we breath constantly poisons us as our lives march on. For almost 3 billion years it was nothing but a poison but then life harnessed it to also make energy.

No, there are infinitely many. Radioactivity limits the variety we actually come into contact with to 92 significant groups. Each of those is actually several different types.
http://en.wikipedia.org/wiki/Table_of_nuclides_%28complete%29
shows all of them in close-enough-to full detail.

That doesn't follow at all.

And each of those three things are constructed of smaller parts that can be combined to make other particles that are all involved all over our universe but that are harder to pluck out and look at individually. The way that works is kind of what paricle physics is all about and why we're so interested in finding that Higgs Boson. We know that you can convert these into other types of particles and if strings are that next step down in size we've got a lot of ideas about how the smallest pieces work. With strings we would having simplified things all down to one single unit everywhere.

Oh, for the last few sentences you've been talking like calculus and the atoms we see divided by the potential atoms approaches 0, right?

Sorry but calculus doesn't work like that. Right here I'm only going to focus on the random chance bit though. Look at that graph.
Here it is again in case you've scrolled past it already:
http://en.wikipedia.org/wiki/Table_of_nuclides_%28complete%29
That's not random. Look at all of the patterns there. The chances of several hundred atoms that already have patterns of behavior organizing into life?
Well I actually can't say. We've just got the case of that happening on Earth to go by and that's too small a sample for statistical probability. The margin of error is so huge any number given would be meaningless.
But if we're right at the middle of the margin or to the one side of it then the chances are high enough that it should happen thousands or millions of times per galaxy.

However, with these foggy probabilities who's to say that you can't get at least life from almost any combination of atoms if you give them a wide enough variety of situations to sit in? If the observable universe is any indication the rest of the universe just goes on infinitely so surely we'd have every possible circumstance happening somewhere at some time.

For us life has come from Carbon, hydrogen, nitrogen, and oxygen. We throw in some other molecules for certain things but it's those four that do basically everything. They're also light molecules meaning that they're quite abundant. If we came from rare molecules that should have never otherwise met each other you would think a creator was involved but instead we came from some of the molecules that meet each other most often. Carbon forms chains easily which is critical for our mode of life. Oxygen breaks strong molecular bonds. Nitrogen is kind of a toned down oxygen with the opposite electrical charge in complex molecules. And hydrogen works as a way to dead end chains and control the direction the chain goes. With any four different atoms that did things like that I don't see why you couldn't make life (and life like ours so long as things had a polar liquid at temperatures at least as high as liquid water but not so hot that they broke the molecules up.)

So no. One type of atom is very different from 100. Viewed in infinity the difference seems minuscule but single atoms can only hope to form crystals while having several with different properties allows controlled interactions.

That if you jump into a frame of reference where the numbers aren't meaningful you can't tell what's really happening?

Calculus isn't about comparing discrete numbers. It's about comparing variables. Variables that increase slowly are nothing compared to variables that increase quickly after just a short while.

With our universe being all random chance and happenstance these things would be variables but the only reason to call it chance comes from you saying that it is the only alternative to a creator. You've been asked why the origin of the creator shouldn't also be chance and I've been insisting that there is an option that has neither an intelligent creator or just blind luck as the origin of all that is around us but you don't want to hear either of those things.

Why shouldn't any number of atoms organize into grand complexity?

Me either.

Oh don't worry. You've earned the slander. If this has insulted you then you feel at least as insulted as we all should.

I don't mind so much when an argument goes nowhere because neither party can find a way to progress it but when it goes nowhere after I've shown directly that your 100 atoms thing is bunk and you just reply with "100 atoms, it couldn't happen like that without a designer!" and we go back and forth between me saying "ya, that didn't happen" and "it's impossible" frustration builds up.

It's best not to dwell on the insults for too long and just try to focus on the actual meat of the argument.

100 atoms. Searched. Anti-verified.

Oh, about time you modified it.

You haven't even made the vaguer estimate of 100 billion stars per galaxy and 100 billion galaxies.

70 sextillion stars doesn't exactly give you anything useful for the designer stuff either. Really the only reason for that number to be what it is is entirely the size of the area they are in. If we could see further the number would be different~

Because at the very start they had to condense of of thick energy and you get almost all 1 proton and 2 proton atoms from that. 3 protons takes more energy input. 4 takes even more and so on. It's as if we're counting and the bigger numbers are harder to make!

But for just a second imagine that you have a jar with 10 marbles in it and another jar that is the same. Let's say you take all the marbles from one jar and glue them together to make a ten marble "atom" and you put it back in the jar. The other jar has ten "atoms" in it but the jar of size 10 "atoms" has only one. Why are there less of those?

So unless you really are asking "why does combining ten things into one thing give you fewer than ten things?" and similar counting questions the answer should be as obvious as why mothers don't eat their babies for energy (well now I'm worried so I'll just give the answer to that: there wouldn't be any babies.)

If you don't count math as a science.
Hearing this is insulting. I told you that clustering more positive charge close together builds up the force that makes atoms split. I told you that adding space in between with neutral particles helps alleviate this but that in order to stick together they require a certain degree of attachment to protons.

I told you that we SEE 92 types of atoms because at that point the neutrons fall apart really fast. It's like saying that above 1000 degrees plants catch fire and then you asking why we don't see any plants above that temperature AND SAYING THAT SCIENTISTS HAVE NO CLUE.

About about 150 neutrons atoms fall apart. That is why.

Strong nuclear force. Weak nuclear force. Look them up.

oh hoh hoh.
I'm glad I wrote that one about how you're saying it works your way or it works like your runner up and the rest of us don't even get options.

How many times have I told you it's not random chance? I think I've been drilling that idea since I got here except for the one case where I called mutations stochastic.

x volume of energy = one proton. y volume of energy = bonding two protons together.
If you divide it all by x you get a big number. If you divide it by 2x+y you get a number that's not even half as big. So if you can carry numbers in your head very well you may notice that the 25% helium from the early big bang would mean that it was actually hot enough to make helium a lot of the time rather than just hydrogen. It's 1/4th of the atoms but >2/5ths of the energy.

-Now I think I know what you meant to say and for my response to a better query of the "if it's random question" you'd have to be reading what I say to JB and I understand why you wouldn't- this is a lot of text to go through.

But even the origin of our universe isn't random chance. Ok, I don't know that for a fact but it is definitely not what I am supporting.
I may not know what processes go into creating a universe but that doesn't mean it's 100% blind chance. Sure, you might have universes where the stable atoms count up to 173 or only just 62 but I can't say that those are as likely as our own universe. If it was completely random they would be (and you might even get intelligent life on them,) but maybe it's more like quantum physics and you can only get certain discrete values for a universe.

If you don't want to take this seriously and you want to keep saying anything not understood is 100% random fine but there will come a day when we do start to understand and you'll have to reject reality, be dishonest and move your goalposts, or admit mistake. Well no, there's a good chance you'll just die first but the idea you are waving around will die then.

Yes. Random chance doesn't explain that. Random chance also doesn't explain how so creator would originate either.
If a creator gets to come about by non-random chance why don't we?

Infinitely many blew into existence as only one type of atom. Some of those fused and we got a second and then a third type.
*my understanding is that maybe those other two became "atoms" at the same time as hydrogen. I'm not perfectly clear on the energy densities there.

Actually no. Look up solar flares and you'll see there's a whole lot of instability. The magnetic fields on stars are all skewompus.

Not randomly though.
G-muv + Lambda-muv = 8piG/c^4 *T-muv is how that happens. Very much not random.

Again no but I'm tired of repeating what I've already said so we'll just continue.
No, but there are options that are not "random chance" or "designer."

Besides all of your arguments are garbage anyway because of the false dichotomy. Shooting down "random chance" doesn't have jack to do with us having an intelligent designer. You don't go arguing that the sky isn't red so it must be green do you?

Show me that you can even read the equations for any of the phenomena we've discussed and maybe I'll give you some credit for that.

In high school they gloss over all of these things and try to just run students through them so they have the barest familiarity required to get a real education on them or at least not vote like an idiot after experts have explained an issue to them.

And the cutting edge is what tells you why the trailing part behind it is how it is.

Do you think ideas themselves just come from transforming the air you breath in or would you say those are created from nothing?

That stuff lacks a certain depth though. The reason humans "suck at art" when they start out has to do with the way we think symbolically. A stick figure of a horse looks practically nothing like a horse but we can tell it is one.

Turns out there are some interesting experiments people have done where they manage to temporarily shut down portions of people's brains and normal people can well enough stop drawing symbols and go to drawing what they see with certain areas blocked out.

It's kind of flat art though. For something to have meaning and relevance to our society you need to mix realism with symbolism. (Or substituting other things in place of realism depending also works on the audience.)

Isn't it kind of nasty to strip creativity away from people saying that it comes from the part of them where their personality and knowledge aren't present?

Like what?


So you're saying that we would all progress from infancy in a uniform fashion if not for that intelligence that's everywhere?

Shouldn't it be the other way around? If we were all connected to that thing wouldn't we all have the same sort of creativity?

Actually that's growth chemicals and I've already told you several times that the eye spots are "painted" by the genes that grow feet on a caterpillar.

Please don't convince me that you aren't listening or never remember anything I say more than just long enough to write a reply to it.


There isn't an original "eyespot." Each butterfly is a slight alteration of a butterfly that came before it trailing back through other insects, arthropods, precambrian life, and eventually going back to something like a bacteria. With insect wings in general you've got something of a teardrop shape with a bunch of little fibers running along it. I might be remembering this incorrectly but before the wing hardens those act like blood vessels carrying fluids around for growth. Before butterflies other insects already made themselves some color or another to get eaten less often so that's not new. Butterflies moved numerous colors into their wings but it was all there before. As I've said they control the growth of those colors with the same genes they use to decide if cells should be a foot, antennae, or just general body wall.

So basically what I'm saying is that calling that a design is the same as if I took a picture from my hallway and stuck it on my bedroom wall and you went praising how fantastic the wall looked. "Surely there's no way a ship could just show up on the wall there!" Well ya, it couldn't. It was printed onto some piece of fabric and my grandfather spent months sewing the colors into it.

Although that scenario is still all design I'm comparing it to sudden creation and I hope that you can see how I'm comparing evolution to design with the butterfly thing.

I don't get how you can know a term like ad hominem but not understand arguments from ignorance or authority etc.

But besides, it's not an ad hominem as I'm not using it as an argument. I was just saying it to hear myself make typing sounds (and to influence you a bit.)

I'd forgive me because I'm honest. Around here that's fairly significant.

Ya, I guess I'm misunderstanding the question. Can you ask it in a less vague way?

You attacked my character the last time I said you didn't understand something.

No, I'm making comments about your knowledge of science because of all of the horribly inaccurate things you have declared to be the way of the world and more importantly because you labeled yourself as an authority on science. So seriously, tell us what you taught already.

No, you gave fallacies for design n_n

Man you must have been a crappy science teacher.

Alright, the distinction between dark matter and dark energy are outside my expertise so I guess you win that point.
*that's actually a really terrible reason to say your argument is any good.

Actually space is expanding rather than the things in it moving outwards and I'm not aware of any equations that say the expansion of space should require energy input so I don't understand that one either.

POSTULATE does not equal STATE. They're saying maybe there are strings and saying generally where to look to find out, but not that is even something you should have heavy expectations of.

And they WILL be wrong. Not necessarily entirely wrong and even right in general but when we actually get a chance to look it's not going to 100% match their expectations through and through.

Well basically you're attacking one view with the implication that if it is wrong yours is the only alternative and when things are different from what you thought you... you don't even acknowledge it, you just edit it out.

Exactly what do you think things would look like without a creator involved?

That's talking about energy, not sizes.

But what's so bad about proving old ideas didn't te the whole story anyway?


If we observe the effect something has it's not entirely invisible.

So tell me what there is that makes the designer not invisible. I tore up the questions you had before, have you got anything else?

I'd be much happier with your doing it if you understood it.

You sure keep saying that we can see the design a whole lot.

Ok, maybe this will help. You can't see wind but if your laundry is hanging out to dry you can see the wind push it. We thinks of seeing wind as seeing everything in it's path bend or fall over it the direction the wind is blowing. Show me that stuff for your designer.

Yep, string theory doesn't fit Occam's razor so it's not a default. If we observed those seven dimensions and they had the properties they should have according to string theory then maybe it would end up the simplest explanation but right now it really is just a popular guess people are excited about finding evidence for or against.

You've said there's unnatural order to EVERYTHING and thrown in an extra consciousness (or several) for that to wiggle in.

CONCLUDE does not equal POSTULATE.

And cosmologists[/russia] say anything about what dark matter or energy are like? This isn't holding up sir.

Well yes, and you incessant lol'ing at me with so many emoticons doesn't help the case for you wanting to be taken seriously.

I think I've made it obvious enough by now.

Oh I hate the excuse the early rapid inflation. "It's too similar" means what? Too similar on what basis? People say the "stuff" would have to have been much closer to be so similar but wasn't it supposed to have basically been right on top of the same point at the start anyway?

*I understand that it probably matters if things were close before or after the universe went transparent and atoms being present and so forth but I've never had an official explanation of what exactly the reason for that is, just the watered down Discovery channel special explanations that don't really tell you squat about physics.

We've split atoms and made the quarks recombine into other particles. Not good enough?

Naturalistic causes. Check out every field of science if you'd like to see what some of them look like.

And please stop asking questions I've already answered. Leading things in circles would be alright if you were ritical of my answers but you seem to just ignore them and chop them out of these replies.

Only "evidence" I've seen for atoms being designed was your claim that there are 100 specific ones. There aren't 100 specific ones, plain and simple. What other "evidence" have you got of atoms being designed?

Any reason that shouldn't be?

It has infinity types of atoms. Some of them split faster than others but you DO NOT HAVE ONE HUNDRED.


Nice claim. It would be nicer to just postulate it instead of trying to make it the default option but it would be even nicer if you would give some evidence of it.

Actually no, it doesn't.
RNA has the ability as it folds into ribosomes (and if you know jack squat about DNA you know the roles those serve,) and it folds into little units that match up to other RNA with a ribosome to stick amino acids together. Amino acids do all of the work in cells RNA doesn't and DNA came after that combo.

So programmers make programs that crash. This program doesn't crash.
A: no programmer did it.
B: Scratch out A like it isn't even an option and say that it's just a really good programmer.

Well, we know which option you chose.

No, having all of the proteins and RNA configured to read the DNA the same way and having the same chains of reactions set up in our cells are huge parts of it too.

There's not just one. Even of the amino acids we do use in most cases only four classes they fall into matter and you can interchange any of them within those classes for a protein that will have the same function. And with RNA there are only 4 options to begin with.

Actually we see that a lot- sort of. With C+ and similar languages you should know that they crash about as soon as anything abnormal happens but with Java it tries to keep going and just shrug off the errors. Life falls somewhere in between.

How would we see that? DNA is relatively durable compared to RNA and proteins but even just a few million years and it degrades pretty heavily. How the hell would we still have any from almost four billion years ago?

Or did you completely ignore when I explained why we wouldn't see any programs pop up after our planet already had one going?

So you understand that early bacteria would eat the materials it takes for abiogenesis right? And you understand how without the materials you couldn't get a second one popping up right?
And did you catch where I said we could have had lots pop up but before switching to DNA they fused together in a variety of ways?

Well with you bringing that stuff up you obviously didn't so thank you for reading what I say. I'm so glad you value my input -_-;

Actually yes before. Looks like you didn't read where I talked about membranes and making copies of RNA and proteins either.

Yes, it would miss it. Good thing I went to all that effort going into the origin of life that you didn't read.


I can see now you're one of those goalpost movers. The "real miracle" is whatever step you think the person you're talking to can't explain. If they do, well, you can move it back to whatever else they can't explain.

If your view was default sure. It's not.

Survival of the fittest. You can do math can't you? n_n

You don't listen very well. I've already given other justifications for it. I'd give more but I'm going to wait until I think you can be trusted to actually read my posts in a way that you comprehend some of what I say.

But things are moving in straight lines away from us. If we check out the speed and turn the clock back we find that 14 billion years ago everything would have been right on top of us.

And quasars are supermassive black holes at the centers of galaxies. Most or all galaxies have them but in a quasar there's a lot of gas being sucked in and that gas rubs against itself until friction gets it so hot that it's that bright. You can see the same kind of thing happen in the formation of any star but at lower temperatures and thus lower brightness.

Oh that stuff is falsifiable. They're making predictions left and right, it's just going to take some time before we can look at anything big or small enough to really check.

You know big bang? With everything being dense gas that got less dense that means there should be background noise everywhere at a small value. The guy who did the math didn't get a chance to check but eventually two radio workers did and for finding it they got one of those Nobel prizes.

After we've got stuff like the Higgs Boson out of the way we can maybe make some giant contraption to work on something very string specific.


The folk against abra and the rest around here are willing to accept proof but we're got certain standard criteria (mostly dating back to ancient Greek philosophy,) so some things are a no go.

"I don't understand how there could possibly not be a designer" isn't proof. I've explained a few fallacies to no avail before but if anyone doesn't understand why that's bad just look up argument from ignorance.



There are things where if you disagree you're just wrong. If you disagree that the number four comes after the number three (only integers) the system of mathematics doesn't care. If you refuse to count higher than 12 and there are thirteen eggs on the table disagreeing with anyone about how many eggs there are does not change how many eggs there are and your view of twelve is inferior to their view of thirteen.

...If you say there is the magically whole number of 100 atoms but anyone who knows better points out that there are 92 stable atoms and infinite isomers...


Evolution is defined (within the actual field) as the change in the frequency of alleles in a population over time. You can flat out watch that happen.

I suspect that by evolution you mean "everything from big bang to the origin of man" as if it's some kind of rival religion of Christianity.
Shame on you. That's a nasty nasty scarecrow argument~

Oh boy...
Well,
http://www.talkorigins.org/faqs/comdesc/
http://www.talkorigins.org/faqs/homs/
http://www.talkorigins.org/faqs/kansas/kangaroo.html
http://www.talkorigins.org/faqs/genetic-drift.html
http://www.talkorigins.org/faqs/thermo/probability.html
http://www.talkorigins.org/faqs/wells/haeckel.html
http://www.don-lindsay-archive.org/creation/eye.html

And with some of the basics out of the way:
http://www.sciencemag.org/cgi/content/abstract/221/4609/459
http://www.nature.com/nature/journal/v336/n6198/abs/336435a0.html
http://www.pnas.org/content/100/13/7527.full?sid=7ac1fa86-58b5-49ea-ab32-74195cec1442
http://www.pnas.org/content/101/9/3077.full?sid=63d56eb2-1b42-4e2c-85df-bdbf76df6e23
http://www.gate.net/~rwms/EvoMutations.html
http://www.uni-muenster.de/Evolution.ebb/Teaching/courses/tut/ws0607/papers/roossinck-symbiosis-competition-plant-virus-evolution-NRM-05.pdf
http://linkinghub.elsevier.com/retrieve/pii/S0960982204004464

I have hundreds more available but I didn't want it to look like I was just bombarding you with more information that you could possbily be expected to go through in a month.

No. If God wanted to be revealed we'd know. There are lot of reasons other possible designers would be limited in action.

That's an awfully limited number of ways we could be the designers. Why couldn't we have designed this without knowing we were doing it do example?

That or cause and effect aren't quite so definite as we wish they were.

Not so much the math. The trouble is that when a photon hits something and bounces back it nudges it a little bit. Thanks to this if we figure out how fast something was going we moved it around enough that we don't know where it was and if we figure out where it was we bumped it enough that we don't know how fast it was going.

Non-particle based information gathering might not be impossible in our physical forms. If you accept psychics and things they can't be doing what they do with everyday particles and the exotic ones usually wouldn't interact with our matter much anyway, much less whatever they wanted to get information from.

Or it's not information at all. Things like radioactive decay happen in statistically predictable ways but the decay of a single atom doesn't even have quantum causes behind it. If you want to talk quantum physics you need to accept that decay as an effect without a cause.

The hell? We can still find out any particular thing, just not certain combinations and other than stuff like the "let's try to make ultra-identical twins" scenarios knowing all of that wouldn't have much practical use anyway.

So if the designer wanted to be revealed it would but instead we have to settles for the stuff that... uh, reveals it? What? You're not even making sense.


And there are people in here that aren't happy with you having free speech but that doesn't have any impact on your having it or not.

Well ya, mud doesn't contain the green and red pigments you see in that and probably wouldn't do a good job of the blue ones either.

Meanwhile non-life has all of the "pigments" and once you get certain combinations of them they go making more of themselves.

I know I've been a day or two behind in this but I'm pretty sure my post where I explained that you were wrong about there only being 100 was before this.

CAGGACGGACAACATGTCAGAGCTAGCTACCATGCATAGC
Doesn't mean squat to you does it? Picture that stretching on for hundreds of thousands of letters.

Well no. You can fit all of the information of what parts of your DNA make you onto a standard CD.

You've been arguing that it was all programed by hand starting from molecules and going up to the highest degree of interaction you comprehend.

But it's nice to finally get a formal irreducible complexity claim from you. I know that recognition of the simple steps leading up to what you're looking for wouldn't sway you in the slightest but it would disprove your claim by all reasonable standards.

Agnostic my ***. If that's what you were you wouldn't be dismissing non-designer views as happenstance. You'd have to be saying that happenstance and designer seemed equally likely and that you couldn't pick one, or better yet not calling it happenstance at all and addressing the actual view.

It's called tRNA. Look it up.

No, that's definitely solipsism. The other words were just there so people would know what I was referring to because I felt I should prime people's vocabulary to make sure they knew what that word meant.

You're right, I've only said that legos built up as a castle would be order and legos scattered when a club hit that castle should be disorder. How could you ever find the implicit definition in that?

And again, since you have offered no other meaning, my meaning stands because no other alternative has been offered. In the vernacular, put up or shut up.Thermodynamics for 200.


You cause people to respond to you like this. The ideas you express only start people questioning you but it's the way you interact that makes everyone so hostile.

Importantly, this means nobody came here with the interest of tearing you down.

When you learn about the history of which scientists discovered which things you hear about a lot of people that hated each other. They disagree entirely because they're so disgusted by each other and they can't even stand to be in the same room (sometimes even when it's an auditorium,) but even in that situation one can gather up evidence for their work and the proof does it's work.

People disagreed with Columbus about it being possible to sail to another continent through the Atlantic but he went and did it and then made several return trips. He gave proof and then afterward people agreed, not the other way around.

Like hell you have. You've been able to show that you don't understand many of the physical sciences or logic fallacies.

DNA is a relatively arbitrary information molecule. Non-Earth life could very well use other carbon chain molecules for the same purpose, though relatively small and stable ones should have an advantage for obvious reasons.

Well I think I can rule out you being a biology teacher. The human genome project was a particular venture to sequence only the DNA of humans that took 14 years to complete but helped to drive advancements in DNA sequencing machines.

Genetics in general support the universal common ancestor concept though with more recent understanding of how much less distinct the species boundary was early on the tree of life has what resembles, slightly, roots. From DNA it's not possible to say that the original cell arose only once as the common ancestor itself may be have been a chimera of chemical products.
But presuming it did just happen once there was basically some incest in the family tree, though be careful to understand that context as at this point there would not have been sexual reproduction yet.

That's a really inaccurate statistic. People have been saying that before the human genome project (and as we sequenced the full genomes of humans first we would have only had certain viruses and bacteria to compare it to. Currently we've sequenced most or the things we regularly eat and several species of interest.

But this is easily misleading. Sequencing a full genome is still expensive so a great array of techniques for picking out particular stretches to sequence. Often months and months of narrowing it down are preferable to paying the fee to sequence a large chunk of DNA.

Your statistic is most likely referring to mitochondrial DNA but who knows how many steps of the telephone game it could have gone through before you heard it.

Now, we do share surprising details with things even so different as bacteria. The general trend is that proteins inside of the cell are very nearly identical but plants, animals, and fungus (and some things I'm not going to explain,) have their major differences in proteins that stick through the membrane, which happens to be how cells communicate between each other. The same chains of interactions are there but the first step that sets them off is in the membrane for us so other cells can control it.

That would be a good reason but it's clear you don't know the chemistry. There are hundreds of amino acids of varying types but we use only a particular set of 21. There are a few microorganisms that have a single change in their genetic code that uses a different amino acid and it works. It could work for us but we just don't use it.

Likewise there is a whole lot of other chemical setups that we COULD use but don't. There were lots of other chemicals available to us but much like a racing car you can't tack on every option there is if you want it to go fast; you've got to streamline things.
And some early cells did and we're all descended from them.

If you want chemistry tutoring I can go into tons more detail~

Not at all. It could take thousands or millions of years for nonliving material to make all the parts for proto-cells but something like a bacteria- well those can divide in an hour if conditions are about as harsh as they can possibly handle and if you keep doubling like that you get billions of cells in just two days. Think how fast those would get into just about every corner and crevasse and you can see how they'd get everywhere and gobble up all the organic material to make more of themselves in the blink of an eye compared to how long it would take a second early cell to form.

Once there is anything to compete with abiogenesis doesn't have a snowballs chance in hell but if left alone for a million years it might happen practically everywhere it possible could.

Inaccuracies aside that's pretty good. We've actually got the tools to start on it now and there are several people working on making a cell from scratch (to varying degrees,) but sadly, they probably won't get full results this decade.
But hey, you've got to start somewhere if you ever want to figure out how things work.

For life like ours you need something like 30 genes to have a chance to function (based on comparing bacteria.) After we've worked that out in full detail (or close,) people will be able to realistically work on actual "from scratch" systems to accomplish the same thing.

Immediately. Mutations aren't programmed into the DNA, they happen with external conditions. Different sunlight, chemical intake, temperature differences (and really just about anything) can cause them and it's effectively impossible to put two copies in so identical an environment.
(Plus background radioactive decay isn't something we can any control over so we'd need whole other ways to make things "identical.")

You know how kids have a 50/50 chance of being a boy or girl? It's like that. If you had two identical sperm fertilize and egg you'd get the same gender child but you couldn't ever make the whole sex act so identical to definitely get that same result. Single parts in a test tube or petri dish and sure, you can control which will happen but as you add factors in it gets much harder to control.

Well with sexual reproduction "diverge" refers to when the immune system makes the fusion of sperm and egg impossible but the lines are fuzzier with asexual reproducers.

I know all about that n_n
But is that the "science" you taught?

Well if you want to think of it like that the deoxyribose backbone is the hard drive and the nucleotides are the program.

It's important to recognize that all of the parts that translate the program are like the programming language- DNA alone is just like a meaningless string of 1s and 0s if you don't have the right stuff to decode it.

-and like I said with JB, these aren't perfect comparisons. These are the closest I can compare and hopefully you get the general idea from it.

So basically your evidence is "it seems crazy to me"? Of course new information doesn't sound like it makes sense in your understanding of the world- it's new. People thought the Earth going around the Sun instead of the other way around was too crazy to be true but they kept looking and people became familiar with more of the details and eventually people realized "ok, the way we thought it worked was too crazy to actually be it." (In particular the geocentric model with epicycles was wrecked but moons orbiting Jupiter and Shadows on the face of Venus ((sometimes it had to be closer than the Sun and sometimes further,) but these weren't absolute proof; it's just that that was the point where people understood well enough to recognize how much they would really have to do to make the geocentric model really work.)

That's not a valid argument. Sorry but anybody acquainted with fallacies knows not to accept arguments from ignorance or ridicule.

So basically you're saying it is irreducibly complex? That argument was shot down back in Kansas.

I don't see the connection. Why shouldn't the results of the big bang act this way without a designer behind it? Seems like most of it is just the simple math of "things that happen more often are the ones you will see the most of."

Again, why? What's the limit of what things without design should be able to do? Why is that the limit? If you've designed so many things why not say that too few things have gone wrong for it to be designed?

Thank you for admitting that throwing a designer into a mix doesn't make the origin of life in our universe any less of a random chance to you. I can't understand for the life of me why you care less about the infinitely improbable spontaneous origin of some god than you do about the apparently moderately probably origin of our universe and life within it.

Your argument has been that this is all too complex to have been the results of chance but some God that sets up such a complicated universe would be even more complex than that.
And if you don't think so you shoot yourself in the foot because you're admitting simple things can lead to complex things and an admission like that dispels any notion that you would need design for our universe to turn out like this.

Should I talk about more space polar bears trying to control our bladders or are you just never going to get that some guesses hold a lot less merit than others?


Personally my brain chemistry is just wonky enough that I've experienced those things without drugs.

Luckily it's also stable enough that I can tell them apart from reality. Tripping out doesn't seem to really give me experiences that seem remotely spiritual in the first place though so it might be easier because of that.


Actually that's one of the first things people hear when they look at these topics. The idea was basically dropped when we realized that time didn't stretch eternally backwards and that our universe had a point where there couldn't have even been planets for life to be on.

Player Skyhook
+3 exp

Level up!
mysticism: +1: 6
unrelent +1: 9
hibidyjibidies: +3: 13
logic fallacies +2: 16

Class up! Junior Disciple of the Cloud Technomage

If it doesn't look like chance we toss chance out and move up to the next simplest thing as the null and so on until we don't have any evidence that doesn't fit.

I hope you're not a scientist

You don't seem to grasp the fundamental concept of Occam's Razor.

Goop shaped like what?

I wonder if you've seen that post I made about not knowing how many sides the dice has or what numbers are on it...

Because the designer you're supporting is invisble and silly.

Which is why something is only a null, not a supported theory. Evolution is a scientific theory. Planetary accretion, fusion, and big bang are the same. String theory is, perplexingly enough, not a scientific theory, or at least not until we've got some evidence for those strings besides "the math checks out."

Once something is a scientific theory believing differently means rejecting observed reality, unless you've got evidence that doesn't fit it.
Believing differently than the null just means you have beliefs. Until there's support for some part or another the null is just the starting point and if you're so inclined you should go find some evidence for or against it.

You understand that default doesn't mean "this is the only option" right?

Again, naturalism explains quite a bit if you're willing to stop trying to force it to mean "nothing but unguided luck."

Then why haven't you?

but only in the light of God, right?

It's saying things like this that prove to me you were never a science teacher, or at least not a remotely good one.

Energy flows from high concentrations to low concentrations and for one type of energy to do otherwise another type must flow even more in order to push it like that.

Can you think of many physical phenomena that don't follow that?

Naw, you're just abusing what I've said.

What I said was true. The problems all come when you turn it into something different.

So I guess that's one more tally for scarecrow argument. You're racking up a whole lot of fallacies here.

Nope. We DO KNOW THINGS. We don't know everything but the null is the minimum we can say with what we do know. I've illustrated repeatedly that we all innately understand that it's foolish to inflate things past that.

The null is fairly atheistic but you're right in not calling it support. It's just the reasonable stance to take when you aren't having your faith choose your stance.

You'd agree with me more if you knew what I was talking about?

Yes, the null.

Naturalism explains.

I'm going to treat you're deaf if you keep equilibrating those two terms because they have very different meanings. JB was pretty annoyed by my picking apart the psychology of her sharing her opinion and arguing for it when it wasn't asked for but what you're doing is much worse.

So basically you're saying "God is the single source of all meaning and purpose and he either created us with those things or we are just meaningless random chance and anyone who thinks differently than me doesn't get their own options because they are less that human."

Now, I've been trying to stay on the science subject here but you seem pretty fixated on atheists so: they agree with you about most things. We have a purpose, there is good in the world, you should rape kill and plunder your neighbors, etc. The thing that is different is that they say there are reasons for all of those things other than God. Those things are there, and there are reasons for them, and atheists say there's no God.

They are rejecting "God is the origin of all things good," not that there are things that are good.

...well, ok, there are the nihilists but saying they represent all atheists would be like saying the flat Earth society represents all Christians.

And so with this I am giving you one more chance to show that you are capable of empathy and some God damn human dignity. If you're still acting like naturalism can't be anything but happenstance after page 35 I guess we'll all know what kind of person you are.

If A then B. B therefore A.

...children cry when they don't get candy. This child is crying. It couldn't possibly be a genuine medical condition and they must just be whining about candy.
...

Naw, I don't think it works. That one is the affirming the consequent fallacy by the way.

Yep, definitely different tendencies. I could turn this into an argument about if they are born wired differently or if the way our society works is what wires them like that most of the time but that would be a huge tangent.

...the humor I use with my friends...
Well thing is during high school most of my friends were girls. My sister is the only girl that sort of fits into the "friend" category that doesn't understand my humor so much, though after she married into a social group with humor like mine the tables have turned there a bit.

To be honest in most cases I'm probably too cautious about anything that might be a sensitive subject. IRL I don't joke much until I know what kinds of views someone holds, and although I don't appreciate how warren said I was mean and boring, boring is a good description until I loosen up around people. I still get described positively but "fun" is something I have to learn over with each person I meet.

I've been struggling against that for a few years and I've made significant improvement but it's hard to stay optimistic.

You mean like saying that there are only 100 atoms and that that's some kind of magical number that points to a creator?

Scarecrow arguments, arguments from ignorance, begging the question, appeals to popularity. false dilemmas and analogies, affirming the consequent, and I think I've even seen some complex questions thrown out. If I dug up my old list I could probably name a few that aren't at the fallacy zoo page I've linked.

Remember reading those sentences where I set up the condition that I don't share my beliefs when people weren't asking? Ya, I don't appreciate having that omitted and then being asked questions I had already well enough answered with it.

I understand I jump around a bit but still.
Or have I mixed up the chronology here?

By the rules you laid out it would be.

But hey, should Nazis not have objected to Jews ruining their lives? Whether that's what was there or not that's certainly what they thought they saw.

Don't insult my intelligence, you were just claiming it to be the root.

And here you do it again. What in the world did you mean when you were talking about objections earlier?
But by your own opinions and beliefs you seem to have done something you were criticizing others for. Is this not hypocritical?

Because it doesn't include random extra steps.

If you hear scratching noises at night why is "tree branches on the window" default instead of "demons from hell are trying to claw at the fabric between there and my bedroom and I'd better cover the walls in mustard so they can't get through"? It sounds exactly like either of those things and even if you do find branches scratching on the window you can't wind time back to make sure that's what made the sound the first time, in fact maybe some of the demons already made it out of hell and they positioned the branch there to distract you!


Your methods are awful and I have to dig up explanations for what I thought were common sense in order to talk with you. That you ignore most of them is reason enough by itself to put me at odds with you, but thankfully I am excruciatingly patient.

And if some years down the road we look outside of the universe and personally watch the events that lead to it's origin and we can explain all of the reasons the universe is as it is in terms easy enough for everyone to understand then what?

And I'm not taking the position that there cannot be, just that evidence does not support it.
What we do have is more philosophical arguments for it than against it but that only indicates how popular either stance is as a belief among those that feel strongly about it.

Thus far I see only those questions of yours as the basis that naturalistic origins are not the best answer but that's an argument from ignorance fallacy (and I tore through those like a hot knife through butter anyway.)

It's the default in science. As I have said you are free to believe otherwise. It's important to teach people the default though because otherwise all they learn of what other people think is garbage misrepresentations, like calling any origin without a creator god behind it "chance," "luck," or "happenstance."

Default doesn't mean "100% certified truth." It means "here's the simplest explanation that fits everything we've seen so far," and you know what? My science teacher were very candid about when we'd seen a lot and when we'd only seen a little or nothing at all. Hopefully other people get the same quality teaching.

Try again~

Maybe try paying attention to what I'm saying?

Actually I was going with primordial Earth just to show how different the life would be with small deviations early on.

The predator strategy might be a bit much since this is supposed to be some of the earliest macroscopic life but nonetheless that's pretty interesting.

It kind of irks me when people tell me "women are ____." It hits the same switches in my head as "black people waste all their money on gaudy jewelry."

But I'll try and repress that sensation for now.
I can tell the difference between fun and harm. Is "good sense of humor" the only good way to describe that? I had that in a different version of my profile but it didn't seem to help so I got it in my head that maybe it was't descriptive enough.


I'd say remind how :P
But alright, that sounds good.


Hasn't anyone here ever heard of hyperbole? With mischief near it I would think you'd get that I did indeed mean something less severe than crime.
But sure, juvenile probably describes most of it. It's been quite awhile since I had someone else to do that with so everything of the sort was done before I was an adult. I guess I thought there would be more adult versions of the activities but I don't know what they are.

I might accept this piece but it conflicts with a lot of other people's advice and about the only complements I've had in these threads came from people saying the more descriptive stuff was better.

Anyone have experience with whether the twenty something girls on these sites prefer details or general information?

That does sound like exactly the attitude I tried to make my profile with early on. I've shied away from it thanks to the "whaa, I never get to hold conversations long enough that we learn anything about each other" bellyaching of mine so I think I'll need a little stronger push to flip back to that.


If this site didn't have a rule against multiple profiles I could just make one of each -_-;


I got the impression that so many of them only had that in their profiles because of the waves of creeps that message them for that. Not sure why I hadn't considered sticking it in my profile-

Ya, after my next bout of exams is over I'm going to have some noticeable revisions to make. Thanks.

I have evolved beyond the use of yellow smiley faces :O

The underscore is the mouth with those. The n's are an exaggerated curve for when you smile with your eyes closed, and with the T's picture the horizontal line as the eye and the vertical line as a trail of water pouring out of it.



In case that's too hard to see in words.

Or I guess I could pull out bizarre smileys nobody uses

You didn't say it all at once.
You've said that a butterfly wing is design with the implication that all the patterns of life around us are also design.
You've said that we are continuations of the original creator.
You've said that we are all connected to a universal consciousness that is the designer.

So our bodies are the designs and we are the creator. The creator is the creation.


Not so much religion. Having a mismatched set of chromosomes produces someone with downs syndrome. Physical trauma to the brain produces people with various other mental impairments. Ever seen the shift in behavior someone has after having had a major stroke?

Whether we are our bodies or a larger entity just expresses itself through them the condition of the bodies drastically affects that expression; it alters our very personality. As such the design and the designer are at least linked sufficiently that the designer is indeed the design.

It's not that I'm choosing to not understand. It's that I am choosing not to force my personality into your understanding.

I do intend to understand it but that requires you to describe a great many things so that I don't assume you meant otherwise. I am very much building up a picture of what you have been saying but there are still some questions about it that I can't answer for you.

Well I meant the parts that are hard to convey.

No, you just insist that people who disagree do not understand.

You'll convey enough if I don't frustrate you so much that you leave. If you'd like to speed it up you can tell me about the most varied reasons so I can fill out the range of the spectrum your reasons lie on. I've had a lot of exposure to people on both sides of these kinds of topics so there's a pretty small chance that you'll have many reasons I haven't heard before, I just need to work out which ones (and if you do have anything I haven't seen before that would be neat too.)

Well we can continue with my "here's something reasonably objective I've picked up in my experiences that seems to pose a problem for that reason" format and see if you can throw me any stumpers. It won't very likely change your mind but if you're a genuinely honest person and you can't defend a reason against that you won't be able to call it "a problem" to anyone else's face and with the objective tone I aim for in describing processes maybe you'll even find something useful to share with other people, if only to show that you understand biology.

That would be your opinion and opinions aren't right or wrong so you would be safe from criticism but the problem is that this thread was asking about evidence. Evidence isn't an opinion- it is objective.

You opinion isn't any worse than any other without evidence. It's fine to just believe but sharing it when other people didn't ask is, well, preaching.
You understand why people wouldn't be very welcoming of someone preaching to them when they were asking for arguments, right?

And I give reasons so that people can decide if they agree or do not on something beyond the limit of their own experiences. I don't run into a lot of people that disagree after having taken up that offer but I don't run into many of them who stick around long enough to learn that I was doing that instead of sharing my opinion as they were sharing theirs.

I'm just giving it some visibility among people not aligned against it so much as myself. It is the reason I look for these topics but because you aren't a young Earth creationist of the fundamentalist variety (I think that is probably redundant,) I've stayed for other reasons.


Thin about it this way: If someone asks "why can't we just take what we want? I know how to consider others and moderate myself." you basically say "sure but there are people out there that don't."
That's all I was saying there.

He's heard about science but he hasn't learned or been involved with it.

Or at the very least he sure as hell wasn't a chemistry or physics teacher.

So burden of proof on "this book is the book of God" but not burden of proof on "this dirt is the dirt of God"?


I thought I already said this :P

Again, I'm not against the idea, it just only works as a baseless belief. We keep the default at it's simplest while still explaining everything we have observed so if anyone wants to believe something they can insert it into the default. If you switch from the "against God" definition of atheism to the "without God" definition then sure it's atheistic but that just gives everyone a chance to think whatever they want, aside from when it clearly conflicts with those things we've seen.
The lines between some of these things get a bit fuzzy at times but I hope you get the gist of it.


That's awfully closed minded. Maybe they just seem unintelligent because you've already accepts all the little ifs a certain way that makes them so. Maybe there are damn good reasons for blood sacrifices that you just won't accept as possibilities.

...you don't need to agree with that but I hope you see the similarity between it and what you've said.

What problems exactly did blood sacrifices solve for those gods?

So in other words you are saying it's wrong because it's ridiculous? I really don't like those religions either and I'm certainly not saying they are right but your arguments before them are grossly flawed. I hope that is only due to you not being thorough because you didn't think anyone here would disagree and not because you're incapable of forming a real argument against that.

So what other guiding factor(s) has lead you to "design"?

Alright, point me at some evidence to pursue if you can.

Basically yes, and that's why "there isn't _____" can't shoulder the burden of proof.

I quite agree. Do you think the designer of our universe has any observable qualities?

Does the explanation get to be "an invisible unicorn did it" or do we need to observe some indication of it before we can claim it as the cause of things?

Ya, happenstance is a f___ing mongoloid explanation for things. Only an brain dead idiot would say it was happenstance.

Luckily the naturalistic explanation is nearly as different from happenstance as the designer explanation.

NO. NOT random.

Describe it then.

I fully understand the point and I don't agree with it one iota. Don't kid yourself.

Scarecrow argument. I might as well say the questions is whether the universe is by ghost elves in the spiritual north pole or naturalism. It wouldn't be any further off than what you keep insisting, though since it makes the other side sound stupid I'm sure you'll react much stronger to it.

*"Program itself" might have some problems depending on how you define life.

*If you've heard much about LHC you'll have heard that we might actually start doing that. We're not certain that that stuff works in a way that that will happen but it's a possibility.

I still don't get why you think natural processes are interchangeable with coincidence.

You're right but that's mainly because I've been trying to teach JB about genetics.

Working on it but it's esoteric work so average people don't ever hear about it in a way that they can understand why anyone bothers.

Basic chemistry will tell you about that. The try and sum it up quickly because of strong and weak nuclear forces.

Your question is flawed though as there are not only 100 types. Any combination of protons and neutrons can exist but most of them are very radioactive and shoot off parts or split them until they get to the more stable ones we are familiar with (but even those eventually undergo radioactive decay, just on much longer timescales.)

At the smallest elements you only need maybe one neutron but as you move up soon there's so much positive charge all clustered up that you need more neutrons to glue it together so you need two per proton and then three and eventually you get to where there aren't enough places to grab on to to hold things together.

http://www.ptable.com/
If you look closely you'll notice that the "natural" elements only go up to 92 anyway. The rest we made in labs and only had tiny tiny fractions of seconds to figure out how they behave and such before they decayed.

Particle physics is one of those points where I reach the limits of things I know well enough to describe to normal folk but if you want to know more detail about why different isotypes of elements are more stable than others that is what you will have to educate yourself about.


If you were familiar with big bang instead of that watered down version they start teaching kids in first grade you'd-
well, I'll just try to describe it a bit (but I admit I'm leaving out some important things to keep it from getting much much longer than this.)

Picture that moment after the very start. There was a whole lot of energy uniformly spread everywhere in the universe but things were very compact then so you had so much energy at any particular point that it was just too hot for atoms.

-but as the whole universe stretched there was more room and less dense energy means lower temperatures so in a fashion a little bit like raindrops forming from a cloud of water vapor you had protons, electrons, and neutrons form from a cooling cloud of energy. As I'm sure you know when you put these together they form atoms. One proton can grab one electron (sometimes more or less but it easily gives them away or grabs another one,) so with just one proton you get hydrogen. Things were still pretty hot though so about one in four atoms had two protons stuck together and those are hydrogen. A small number even had three which means lithium but with the temperatures changing the way they did that's as high as things went from this particular trend.

So what about all the others? Well, with enough energy you can fuse these atoms together and if it's a more stable it will even give off more energy that can fuse others and so on.
And where do we find high temperatures after the background cooled off? Well obviously those funky spots where gravity pulled a lot of those gasses together into one of those big balls we call stars.

It's easiest to fuse hydrogen but helium is heavier so after long enough it moves to the middle (down) and takes up all the hottest areas. If the star was big enough it will eventually push down with enough pressure that it will be hot enough to fuse helium. Next element builds up and so on until iron. Iron is a bit tricky as it has the lowest energy configuration- it just sucks up even more heat to be fused without giving any off. This means this whole "star" trend ends at that element.

But there's a way to get enough energy to keep going. If a star is really freaking huge and gets to the iron point of fusion there's something else that can happen. Heat is the main thing that pushes out from inside of a star but because iron just keeps sucking it up pretty soon you've only got gravity pushing things down. With small stars they hold their weight but the big ones are so heavy that the forces of the atoms themselves can't hold it up and the star collapses in on itself until things are so compact that everything turns into neutrons. It turns out at that heat it's actually smaller than the space neutrons take up and they have enough force to hold everything up so it bounces back to a bigger shape and there is so much energy involved in that that we see the star explode as a supernova. These explosions give us all of the elements up to tricky 92.
*Realistically I'd expect a lot of them make heavier stuff but since those elements decay so quickly and already take the most energy to make meaning there are fewer of those atoms anyway they all decay really quickly and we just see 1 through 92.

Miller Urey experiment gets you halfway through that question. To get through the other half you need amino acid chains and RNA chains. These two molecules are able to make duplicates of other such chains- that's not very good though because that's like having no babies while everyone else has lots and you know that's no good at higher scales thanks to that well known survival of the fittest idea.
But if you stick them inside of a bubble they can find a copy of themselves much more easily so inside of a bubble it's like they make lots of babies while others don't make so many.

Right here is an easy piece of evidence to understand: guess what the wall between the inside and outside of cells is? A bubble.
No, I don't mean it just looks like a bubble, I mean it's actually made out of bubble molecules. This is a big part of why just drying off a counter top will kill 99.9% of the microorganisms on it- if you touch a bubble with a wet finger your finger goes in and it stretches over your finger no problem but try that with a dry finger and you rip the layer of water away from it and the bubble molecules go from a wall to more of a powder without a layer (or more) of water sitting on them and a powder can't hold that shape together so it pops.

Well turns out proteins can help to make those bubbles a little bit resistant to water loss so it's good to have them. Chains that make copies of themselves, a membrane, and a reason to make copies of things to keep the membrane around- sounds like all you need for some selection doesn't it?

Obviously more to this story just like big bang elements stuff but that's the general idea and judging by the questions you're asking no, you didn't know about that and I'm not kidding myself explaining it.

Brains took billions of years bucko. That's not quick at all.
And no, I'm not just talking about our brains. It took microscopic life 3 billion years to evolve to the point where they worked out a good enough energy reaction to turn into big complex things like us and you had little more than pond scum before that.

FOR F_CK SAKE NO. I don't call that happenstance. I don't call that random. I call that naturalistic. A naturalistic process happens for a reason and with such defined interactions between things it can happen quickly. Of course we didn't just up and randomly get life on Earth for no reason, much less in a rapid fashion.

Oh good, you were just mocking me. I thought you were dense for a minute there.

Close enough.

Check out string theory if you want to know about that. I think I've typed enough long explanations for one post.
Look at the other people advocating design in here and you'll see people who don't think so.

Why does making more copies of yourself than others eventually make you into a majority? This is a hard question to approach because you are basically asking why is five more than three.

Do you think five being more than three is evidence that our universe was designed?