Community > Posts By > Shoku

 
Shoku's photo
Wed 11/11/09 01:57 PM
Abra
Di wrote:

Oh - I see, and you are so right and I definately share your enthusiasm. I think the "INTERNATIONAL" is what has made the Human Genome Project so productive. I hope this has opened the door for many other scientific ventures it may well be the greatest device we currently have to maintian peaceful and productive interactions on a global level.

And if the genome project progresses and expands we will certainly required some way to maintain peaceful coexistence - expecially since this project will no doubt translate into healthier fetuses and births and add to the quality and quantity of life in general.

That's a lot more people and that will require a lot more cooperation between all societies.


Yes, and I FULLY SUPPORT the Human Genome Project. I personally feel that it's the single most important project that humans are currently undertaking.

Not for the fun stuff like discovering the "boot-strap" code either. I mean that will be fascinating in its own right. But like you point out, it will bring humanity together and be extremely beneficial and productive in terms of curing desease and other health issues.
It's kind of surreal watching you talk about that while you basically spit in the faces of people working on string theory. Is it just that you understand the future application better or do you just see genetics as figuring out how it works while viewing the string theory stuff as figuring out if it's right or wrong?

But along with that will come extremely heated debates about "genetic enginneering" and how far we should go. That's ineviable and rightfully so. Getting too free about playing with genetic engineering could backfire. Especially if we start playing with it before we fully understand it (and we're already starting to do that! That could be dangerous)
Right now we're learning to read (and seeing how things change when we mix parts of two books, so to speak,) but once we start composing that stuff will be important. For now modifying humans is rather lofty and distant.

In this course I recently took on the Human Genome Project, it was also mentioned that via genetic enginneering we could potentially save the planet's biosphere by designing really huge fast-growing trees to replenish rain forests. That's kind of exciting too. But even that will meet with the people who are against "genetic engineering"
Well with as much as I've been using the term naturalism I think there could be some dangerous confusion in bringing this up but...
well "natural" doesn't mean "good." People argue against things as "unnatural" far too often when that doesn't really have anything to do with the qualities of it.

You'd never eat any of the things we do "naturally..." Most of them didn't exist like they do now before we altered them, and I don't mean with genetic engineering. We've already done so much more.

Although, this is what the lecturer predicted would be the most likely use of genetic enginneering on a grand scale. He also suggested that if we take on projects in the plant kingdom on a major scale like that we will learn a lot about genetic engineering before we turn to the task of improving the human condition.
Well when we know the sequence we can "remove" things from the genepool without "losing" them. It's kind of troublesome to build custom sequences of DNA right now but once you've got one strand of it it's easy to make lots.

I think as we get to growing organs we'd be safe and able to undo any mistakes that allowed people to grow mostly normal but with some big problem that came along. In the hard statistics of genetics that could still mean millions dieing but as far as humanity sticking around we could cling on long enough to get over anything we could have "naturally" survived.

In any case, I'm all for it and it's so exciting I wish I could be involved, but I'm at the far end of life right now, hardly in a position to be starting a new career. :cry:
You could still advocate the cause. I'd really suggest learning the formal debate stuff (visit that http://www.goodart.org/fallazoo.htm site for starters,) before you go trying to sway opinion one way or the other in public topics. People are quick to label the side that looks like it uses more fallacies as, well, basically a bunch of deceptive liars who are just fighting for their personal interests.


Di wrote:

Well, we already know that part of our DNA contains viral information,


We might discover that we're just nothing more than overblown viruses with big egos. laugh
Well the viral DNA that "breaks" it's sequence and just sits around as junk is handy some of the time as you've now got the code for several molecules that already have functions sitting in the DNA. If you alter the promoter or similar parts you can throw them into different contexts where they might be immediately useful and if not small alterations can likely get other types that could be useful in some cellular process and you didn't have to wait for them to pop up from scratch.

Well, that doesn't really happen. The thousand year timescale for that is no good for individuals trying to compete against their neighbors. It's more like you don't have to duplicate one of your genes and risk it recombining later and chopping out parts.

Exactly.

And whoever address the concept of asking for proof of something that exists 'outside' of the system whilst demanding that the evidence exists only 'within' the system is being unreasonable anyway.
Was it you or sky that was asking for some evidence of "failed universes"?

Besides, what's often referred to is the utterly meaninglessly idea of a 'pink elephantic smooge' to explain something.

But if a 'pink elephantic smooge' happens to have the properties requried to explain something, then why not?
Basically because we can go ahead and complicate up an idea endlessly to explain anything. We used to say that you got sick because of demons and even today there are some people that think prayer will make you better. Turns out if the sincerely pray to a jar of pickles you have your prayers answered just as often so that either makes the jar of pickles a god, the act of prayer have no impact, the act of prayer not matter where it is aimed, or you've got some kind of wizard confusing the whole business. (I think with a broad interpretation I actually covered all the possibilities there.)

For anyone not already inclined to believe the default of those is that prayer doesn't do anything, or if you've got some information showing otherwise the default switches to prayer's effect not being impacted by what is being prayed to. This is how we think now and it's led us to much better behaviors than what we used to do to try and get the demons out.

Now if you mix the modern "we're going to check to see if things actually work" with belief that it's really demons behind it fine. There's no real travesty that will come from that but it's philosophically weak because you're taking someone else's work and using some white out to stick your source of the phenomenon into the mix without really adding anything. The real strength of these things are saying "I think this is the source and if it is that would mean it works like this and this and this" and then having someone come along and actually show that it works that way; the act of predicting things we didn't know is immensely powerful.

If you went to making predictions you'd definitely be at risk of having them shown to be wrong and you would then have to abandon the idea but if you were right...

Well, taking the current and saying it could only come from a creator is safe (especially the way you've got the creator laying out in the undetermined area where as we discover new places it isn't you can just say it's still further out,) so if safe is what you want so be it.

The problem with a 'pink elephantic smooge' is that it metaphorically implies a meaningless concept (i.e. it wouldn't explain anything even if it did exist)

What about String Theory? Replace "String" with "pink elephantic smooge" and what do you get?
Something that doesn't explain anything. Of course, that's a moot point because strings actually explain quite a bit. At a high school level of detail you'll never know what it explains or why but the professionals aren't putting all their energy into a meaningless smooge. If we work it all out a decade or two later the common high school stuff will give you some vague details on it but it will probably mislead people just as much as high school big bang explanations (if you hadn't been on forums and/or taught it yourself but actually knew the details of big bang you'd never believe how many people think it says some kind of atom exploded."

The only difference is that a "pink elephantic smooge" wouldn't explain what is seen, whilst a "string" would.
That's really only because you haven't said what a pink elephantic smooge is. All words are meaningless if undefined. Point to a hypothetical thing that it is and describe why you'd want to use that as an explanation and you'll be off to a decent start.

btw, I'm probably going to borrow "pink elephantic smooge" if I find that you actually made it up on the spot here like I think.

Well, the same thing is true of the date for intelligent design. A "pink elehantic smooge" wouldn't help unless it was known to be an "Intelligent pink elephantic smooge", then it would help. laugh

It's the attribute of "Intelligence" that is being postulated as the explanation.
Our design seems rather unintelligent. Even the oxygen we breath constantly poisons us as our lives march on. For almost 3 billion years it was nothing but a poison but then life harnessed it to also make energy.

In other words, it's simply being suggested that there is something going on than pure random happenstance can't explain.

The numbers that I was attempting to get at in my presentation concerning the numbers of different kinds of atoms in the unvierse was basically this:

For all intents and purposes, there are basically infinitely many atoms in the universe. Yet there are only 100 different kinds.
No, there are infinitely many. Radioactivity limits the variety we actually come into contact with to 92 significant groups. Each of those is actually several different types.
http://en.wikipedia.org/wiki/Table_of_nuclides_%28complete%29
shows all of them in close-enough-to full detail.

Comparing those numbers, we may as well say that there is basically ONE complex atom!
That doesn't follow at all.

In fact, knowing what we know about quantum mechanics, and the period table all these atoms are indeed constructed from basically just a handful of sub-atomic particle. Basically THREE! Protons, Neutrons, and electrons.
And each of those three things are constructed of smaller parts that can be combined to make other particles that are all involved all over our universe but that are harder to pluck out and look at individually. The way that works is kind of what paricle physics is all about and why we're so interested in finding that Higgs Boson. We know that you can convert these into other types of particles and if strings are that next step down in size we've got a lot of ideas about how the smallest pieces work. With strings we would having simplified things all down to one single unit everywhere.

So the point is that, for all intents and purposes we could genuinely look at this problem as being one where there are damn near an infinity of atoms in the universe and only ONE atom appears that can do all these wonderful things!
Oh, for the last few sentences you've been talking like calculus and the atoms we see divided by the potential atoms approaches 0, right?

That's the point I'm trying to make.

100 compared to infintely many isn't really any different from 1 compared to infinitely many.

So the bottom line is that we basically have one random chance atom that just happened to have the properties to produce a living universe?
Sorry but calculus doesn't work like that. Right here I'm only going to focus on the random chance bit though. Look at that graph.
Here it is again in case you've scrolled past it already:
http://en.wikipedia.org/wiki/Table_of_nuclides_%28complete%29
That's not random. Look at all of the patterns there. The chances of several hundred atoms that already have patterns of behavior organizing into life?
Well I actually can't say. We've just got the case of that happening on Earth to go by and that's too small a sample for statistical probability. The margin of error is so huge any number given would be meaningless.
But if we're right at the middle of the margin or to the one side of it then the chances are high enough that it should happen thousands or millions of times per galaxy.

However, with these foggy probabilities who's to say that you can't get at least life from almost any combination of atoms if you give them a wide enough variety of situations to sit in? If the observable universe is any indication the rest of the universe just goes on infinitely so surely we'd have every possible circumstance happening somewhere at some time.

For us life has come from Carbon, hydrogen, nitrogen, and oxygen. We throw in some other molecules for certain things but it's those four that do basically everything. They're also light molecules meaning that they're quite abundant. If we came from rare molecules that should have never otherwise met each other you would think a creator was involved but instead we came from some of the molecules that meet each other most often. Carbon forms chains easily which is critical for our mode of life. Oxygen breaks strong molecular bonds. Nitrogen is kind of a toned down oxygen with the opposite electrical charge in complex molecules. And hydrogen works as a way to dead end chains and control the direction the chain goes. With any four different atoms that did things like that I don't see why you couldn't make life (and life like ours so long as things had a polar liquid at temperatures at least as high as liquid water but not so hot that they broke the molecules up.)

So no. One type of atom is very different from 100. Viewed in infinity the difference seems minuscule but single atoms can only hope to form crystals while having several with different properties allows controlled interactions.

Now I know that people are going to scream that I'm reducing 100 to 1 pretty loosely. But that's the whole point of the presentation.
That if you jump into a frame of reference where the numbers aren't meaningful you can't tell what's really happening?

100 compared to infinity isn't any different from 1 compared to infintity for all practical purposes.
Calculus isn't about comparing discrete numbers. It's about comparing variables. Variables that increase slowly are nothing compared to variables that increase quickly after just a short while.

With our universe being all random chance and happenstance these things would be variables but the only reason to call it chance comes from you saying that it is the only alternative to a creator. You've been asked why the origin of the creator shouldn't also be chance and I've been insisting that there is an option that has neither an intelligent creator or just blind luck as the origin of all that is around us but you don't want to hear either of those things.

One silly "flexible" atom (that can become a mere 100) produces a living universe of this grand complexity?
Why shouldn't any number of atoms organize into grand complexity?

Pure random happenstance explains this? huh

I can't believe anyone would seriously consider happenstance as a "viable explanation" for this situation.

That makes absolutely no sense to me at all.
Me either.

Shoku's photo
Wed 11/11/09 06:44 AM


BTW that is called supporting my opinion, no argument made, no logic needed, no fallacies, so try again.


No. What it's called is totally unwarranted personal slander.
Oh don't worry. You've earned the slander. If this has insulted you then you feel at least as insulted as we all should.


You don't even know what an argument is either, I made no argument, so I made no ad homs.


I suppose you're right. It was just a totally uncalled for outright personal attack. ohwell
I don't mind so much when an argument goes nowhere because neither party can find a way to progress it but when it goes nowhere after I've shown directly that your 100 atoms thing is bunk and you just reply with "100 atoms, it couldn't happen like that without a designer!" and we go back and forth between me saying "ya, that didn't happen" and "it's impossible" frustration builds up.

It's best not to dwell on the insults for too long and just try to focus on the actual meat of the argument.


You make such bold absolute statements about what science says and NEVER back it up with research. THAT is why I said what I said.


Most of the things I say should be common knowledge, or be very easily searchable on the Internet for anyone who cares to verify them.
100 atoms. Searched. Anti-verified.

I state that there are only about 100 different chemical elements in this entire universe.
Oh, about time you modified it.

I think most people learn that in High School. I shouldn't need to cite any research papers for that one.

In case you weren't paying attention in high school:

http://en.wikipedia.org/wiki/Abundance_of_the_chemical_elements

I state that there are approximately 70 sextillion stars in the observable unvierse. Again, that is easy to verify on Google,
You haven't even made the vaguer estimate of 100 billion stars per galaxy and 100 billion galaxies.

Here:

All I did was type into Google "Number of stars in the universe"

And it gave me this web page right off the bat:

http://imagine.gsfc.nasa.gov/docs/ask_astro/answers/970115.html

But you don't need to trust that site. It's common information that can be found anywhere.

This site says there are about 10^21 stars in the unvierse. It fails to qualify that this is only in the observable part.

I also had given a more refined number of 70 Sextillion. Which is 70 thousand billion, billion, billion. (about 10^21 stars)

So I shouldn't need to cite research to use those commonly known numbers.
70 sextillion stars doesn't exactly give you anything useful for the designer stuff either. Really the only reason for that number to be what it is is entirely the size of the area they are in. If we could see further the number would be different~

The only point I was making is that in a universe that has such a vast abundance of atoms, why such a very small number of different kinds? spock
Because at the very start they had to condense of of thick energy and you get almost all 1 proton and 2 proton atoms from that. 3 protons takes more energy input. 4 takes even more and so on. It's as if we're counting and the bigger numbers are harder to make!

But for just a second imagine that you have a jar with 10 marbles in it and another jar that is the same. Let's say you take all the marbles from one jar and glue them together to make a ten marble "atom" and you put it back in the jar. The other jar has ten "atoms" in it but the jar of size 10 "atoms" has only one. Why are there less of those?

So unless you really are asking "why does combining ten things into one thing give you fewer than ten things?" and similar counting questions the answer should be as obvious as why mothers don't eat their babies for energy (well now I'm worried so I'll just give the answer to that: there wouldn't be any babies.)

This isn't even a scientific question. It can't be answered by science.
If you don't count math as a science.
Science has no clue why this is the case. It just is.
Hearing this is insulting. I told you that clustering more positive charge close together builds up the force that makes atoms split. I told you that adding space in between with neutral particles helps alleviate this but that in order to stick together they require a certain degree of attachment to protons.

I told you that we SEE 92 types of atoms because at that point the neutrons fall apart really fast. It's like saying that above 1000 degrees plants catch fire and then you asking why we don't see any plants above that temperature AND SAYING THAT SCIENTISTS HAVE NO CLUE.

About about 150 neutrons atoms fall apart. That is why.

Science can observe it. But can they "explain it"? No.
Strong nuclear force. Weak nuclear force. Look them up.

And that's my point.

Does happenstance explain it? No. From pure happenstance in a universe this big with over 70 sextillion stars and basically infinitely many atoms for all practical purposes, would we expect to only find 100 different kinds of atoms if they were being created by pure random chance?
oh hoh hoh.
I'm glad I wrote that one about how you're saying it works your way or it works like your runner up and the rest of us don't even get options.

How many times have I told you it's not random chance? I think I've been drilling that idea since I got here except for the one case where I called mutations stochastic.

x volume of energy = one proton. y volume of energy = bonding two protons together.
If you divide it all by x you get a big number. If you divide it by 2x+y you get a number that's not even half as big. So if you can carry numbers in your head very well you may notice that the 25% helium from the early big bang would mean that it was actually hot enough to make helium a lot of the time rather than just hydrogen. It's 1/4th of the atoms but >2/5ths of the energy.

-Now I think I know what you meant to say and for my response to a better query of the "if it's random question" you'd have to be reading what I say to JB and I understand why you wouldn't- this is a lot of text to go through.

But even the origin of our universe isn't random chance. Ok, I don't know that for a fact but it is definitely not what I am supporting.
I may not know what processes go into creating a universe but that doesn't mean it's 100% blind chance. Sure, you might have universes where the stable atoms count up to 173 or only just 62 but I can't say that those are as likely as our own universe. If it was completely random they would be (and you might even get intelligent life on them,) but maybe it's more like quantum physics and you can only get certain discrete values for a universe.

If you don't want to take this seriously and you want to keep saying anything not understood is 100% random fine but there will come a day when we do start to understand and you'll have to reject reality, be dishonest and move your goalposts, or admit mistake. Well no, there's a good chance you'll just die first but the idea you are waving around will die then.

That's my question, and I my answer is, no, happenstance doesn't not explain that.
Yes. Random chance doesn't explain that. Random chance also doesn't explain how so creator would originate either.
If a creator gets to come about by non-random chance why don't we?

I'm not claiming that science holds this view. But I do claim that mathematically it is not what we should expect if atoms are indeed happenstance. (This should be obvious to anyone!)

What can I say about that? To think that infinitely many atoms just blew into existence from happenstance on only 100 different kinds appear is not what could be called a 'happenstance' event, IMHO.
Infinitely many blew into existence as only one type of atom. Some of those fused and we got a second and then a third type.
*my understanding is that maybe those other two became "atoms" at the same time as hydrogen. I'm not perfectly clear on the energy densities there.

Especially in terms of any attempt to claim that happenstance "explains" this! It doesn't "explain" it at all. On the contary it would be a truly freak happenstance event if it is indeed happenstance. So happenstance most certainly does not quality as an "explanation".

~~~

That's merely the first part of the observation.

~~~

Now we look at what these extremely few atoms just happen to be able to do.

They come together to form stars that burn for very long periods of time in a stable arrangement. (Surely I don't need to cite the fact that stars burn stably for billions of years. That's common knowledge)
Actually no. Look up solar flares and you'll see there's a whole lot of instability. The magnetic fields on stars are all skewompus.

The form plants that happen to circle these stars in nice neat orbits provising long-lasting stable enviroments. (again, do I need to cite the formation of solar systems and planets? Most people already know this stuff)
Not randomly though.
G-muv + Lambda-muv = 8piG/c^4 *T-muv is how that happens. Very much not random.

Then these atoms also form Molecules that can self-program themselves to become highly sophisticated sentient beings.
Again no but I'm tired of repeating what I've already said so we'll just continue.
(again, do I need to cite DNA and evolution? I think everyone is already aware of this, even if they don't necessarily accept it. It's common knowlege).

Then I ask, from a personal perspective again, "Is happenstance a reaonable explanation for a universe that just happens to be made up of only 100 different kinds of elements, that just happen to be able to produce the environment and molecules that can self-program themselves into conscious thinking beings.
No, but there are options that are not "random chance" or "designer."

Besides all of your arguments are garbage anyway because of the false dichotomy. Shooting down "random chance" doesn't have jack to do with us having an intelligent designer. You don't go arguing that the sky isn't red so it must be green do you?

I give my own personal conclusion which is, "No, happenstance does not explain this at all. This is definitely not what we would expect from a mere happenstance event.

You're millage may vary. Dragoness doesn't see anything wrong with happenstance explaining this event.

Maybe you don't either.

But to claim that I've misrepresented science in any way is baloney.
Show me that you can even read the equations for any of the phenomena we've discussed and maybe I'll give you some credit for that.

Most everything that I've used for this presentation is common High School knowlege.
In high school they gloss over all of these things and try to just run students through them so they have the barest familiarity required to get a real education on them or at least not vote like an idiot after experts have explained an issue to them.

I shouldn't need to cite any papers for this. It's not even cutting edge information. We've known these facts for quite some time. I knew most of this stuff when I was in highschool back in the 50's. Maybe not the 70 sextillion stars, but most everything else. Plus I new there were a lot of stars even if I didn't have a sexy number to assign them. bigsmile
And the cutting edge is what tells you why the trailing part behind it is how it is.

Shoku's photo
Wed 11/11/09 05:45 AM
JB:
Shoku ,



So our bodies are the designs and we are the creator. The creator is the creation.




I don't use the term "creator" because it assumes "something from nothing." I use the term "designer" because it assumes taking what is there and forming it into something else.

As an artist sculpting a clay figure, I don't create the figure, I take the clay and transform it into the figure. That is a design.
Do you think ideas themselves just come from transforming the air you breath in or would you say those are created from nothing?

The tendency to design happens sometimes in an unconscious manner. Children savants are a good example. A child that cannot function or communicate with others and who seems to be in a trance, creates a work of art that resembles a work of a master artist. Not only that, she is not even looking at what she is doing, and she is creating it upside down... in relation to her.

There are many cases of children with some sort of learning disability that have incredible talent or ability that is freakish by normal standards. Children who at a very young age step up to a piano and play like a master composer. Children who can compute better than a calculator... etc.
That stuff lacks a certain depth though. The reason humans "suck at art" when they start out has to do with the way we think symbolically. A stick figure of a horse looks practically nothing like a horse but we can tell it is one.

Turns out there are some interesting experiments people have done where they manage to temporarily shut down portions of people's brains and normal people can well enough stop drawing symbols and go to drawing what they see with certain areas blocked out.

It's kind of flat art though. For something to have meaning and relevance to our society you need to mix realism with symbolism. (Or substituting other things in place of realism depending also works on the audience.)

These are examples of a creative knowledge and intelligence being channeled through a living creature (in this case human) who seems to have no conscious awareness of what they are doing or how.
Isn't it kind of nasty to strip creativity away from people saying that it comes from the part of them where their personality and knowledge aren't present?

Countless creative designs are created by animals who do it 'naturally' and unconsciously.
Like what?

My conclusion is that they are channeling this intelligence. In the case of an animal you could say it is "instinct" which is pre-programed in their genes or DNA.. but I don't think this is the case given the example of a child playing piano or doing a work of art that is far in advance of his or her actual age and awareness.

So you're saying that we would all progress from infancy in a uniform fashion if not for that intelligence that's everywhere?

Shouldn't it be the other way around? If we were all connected to that thing wouldn't we all have the same sort of creativity?

What I see is evidence of an intelligence that flows through living creatures and uses them for the "natural" design process. I don't think "instinct" could cause a child to draw and paint like a master far in advance of their own ability.

I don't think "instinct" directs the design or 'painting' of eyes on the back of a butterfly's wings.
Actually that's growth chemicals and I've already told you several times that the eye spots are "painted" by the genes that grow feet on a caterpillar.

Please don't convince me that you aren't listening or never remember anything I say more than just long enough to write a reply to it.

That is done while the Caterpillar is encased inside of a cocoon. Some of these designs are the result of evolution over time, and the programming is probably passed on from generation to generation with some variations, but originally, how the design formed is the intelligent designer at work.

There isn't an original "eyespot." Each butterfly is a slight alteration of a butterfly that came before it trailing back through other insects, arthropods, precambrian life, and eventually going back to something like a bacteria. With insect wings in general you've got something of a teardrop shape with a bunch of little fibers running along it. I might be remembering this incorrectly but before the wing hardens those act like blood vessels carrying fluids around for growth. Before butterflies other insects already made themselves some color or another to get eaten less often so that's not new. Butterflies moved numerous colors into their wings but it was all there before. As I've said they control the growth of those colors with the same genes they use to decide if cells should be a foot, antennae, or just general body wall.

So basically what I'm saying is that calling that a design is the same as if I took a picture from my hallway and stuck it on my bedroom wall and you went praising how fantastic the wall looked. "Surely there's no way a ship could just show up on the wall there!" Well ya, it couldn't. It was printed onto some piece of fabric and my grandfather spent months sewing the colors into it.

Although that scenario is still all design I'm comparing it to sudden creation and I hope that you can see how I'm comparing evolution to design with the butterfly thing.

Shoku's photo
Sun 11/08/09 11:36 PM
Edited by Shoku on Sun 11/08/09 11:39 PM

He's heard about science but he hasn't learned or been involved with it.

Or at the very least he sure as hell wasn't a chemistry or physics teacher.


Well, that's the easy out. When you can't keep up with the conversation just discredit your opponent with ad hominem slander. whoa

I don't get how you can know a term like ad hominem but not understand arguments from ignorance or authority etc.

But besides, it's not an ad hominem as I'm not using it as an argument. I was just saying it to hear myself make typing sounds (and to influence you a bit.)

With only 149 posts under your belt, I suppose we can forgive you. Even though your tactics are uncouth and rude.
I'd forgive me because I'm honest. Around here that's fairly significant.

It's funny how you conveniently skipped right over the following:


Have scientists observed Dark Matter?

Have scientists observed Dark Energy?

Have scientists observed Strings?

Have scientists observed "hidden invisible dimensions"?

If not, then why are you jumping on me?

Jump on the scientists for a while!

In fact, they still haven't observed a lone quark. And according to that theory they never will because it's impossible for a lone quark to even exist by itself according to the theory. Yet they still believe in quarks. Because believing in their existence "explains something".
Actually I reply to posts in order as I see them. Being a bit behind in the thread I'm rushing a little but I try to pay decent attention to what people are saying.

You slander other people with no justification, yet you ignore the facts.
Actually I'm focusing pretty clearly on the facts. You claim to have been a science teacher but you don't understand the properties of carbon chains. In recent posts you've mentioned a few decent terms out of astronomy and quantum physics but a college professor would have to know a lot of other material that you don't and neither of those is typically a main course in high school.

But hey, I guess is "there are 100 atoms" counts as a fact to you...

Besides, precisely what did I ever say that was scientifically incorrect? spock
I really haven't the time to repeat everything I've said to you in this thread. Go read the longer blocks of text and you won't be able to ask that question again if you've got a scrap of integrity.

Some of the things that you brought up before were nothing more than your own misunderstandings.

For example, I asked why there are only 100 elements in this entire unviverse that could randomly, by chance, be designed in such a way as to produce the grand feat of evolving into conscious sentient beings.

All you do is try to describe the scientific observations of how that occurs. I already know how it occurs. That wasn't the question.
You clearly don't. You're using 100 because it's a round number and therefore "special" but in focusing on the facts I've thoroughly shown that it's not a special number.

But if you did understand how atoms work you would know that your question is like asking how Newtonian physics should lead to the writing of the declaration of independence. It technically does work that way but demanding someone tell you all about how is rather underhanded.

The question is why THOSE FEW elements exist in the FIRST PLACE.
Because 1 is not the same number as 2 and two is not the same number as 3 and...

I can assure you this much with absolute certainty.

Science has no clue!
The Greeks had no clue when they named them atoms. Now we know they're made of protons, neutrons, and electrons. To understand an atom you can think about magnets. If you've got a bunch of magnets facing positive side in the negative sides are the only parts that could touch other things. 3 magnets will not be as strong as 4 magnets.

Now be careful. Just like how DNA isn't exactly like a program atoms aren't exactly like magnets. 2n^2 describes how many magnets fit in a layer and n goes up 1 every two layers. You only care about the last possible 6 electrons in a layer for saying how the atom will interact with others because those are the ones on the outside and everything else is on the inside and covered up.

...so are you going to ask why things that aren't on the outside shouldn't be the first things to come in contact with other objects the atom bumps into? Are you going to ask why 2 protons aren't the same number of protons as 3 protons?

[qute]And if you claim they do, you're totally misunderstanding the question.
Ya, I guess I'm misunderstanding the question. Can you ask it in a less vague way?

That's all I can say.
You attacked my character the last time I said you didn't understand something.

But for you to make rude comments about other people's knowledge of science just because you can't understand a question, is totally uncalled for.
No, I'm making comments about your knowledge of science because of all of the horribly inaccurate things you have declared to be the way of the world and more importantly because you labeled yourself as an authority on science. So seriously, tell us what you taught already.

Shoku's photo
Sun 11/08/09 09:17 PM
Abra:
Skoku wrote:

I quite agree. Do you think the designer of our universe has any observable qualities?


Keep in mind that what we are discussing is "evidence" for a designer. We're not attempting to describe the designer itself.

Have I given any descriptions of any designer? I don't think so.

All I gave is 'evidence' for design.
No, you gave fallacies for design n_n

Abra wrote:

However, the universe is the object in question and it's hardly 'invisible', it has plenty of observables that need to be explained.


Shoku replied:

Does the explanation get to be "an invisible unicorn did it" or do we need to observe some indication of it before we can claim it as the cause of things?


Why not? This is what scientists do all the time.
Man you must have been a crappy science teacher.

They can't explain the gravitational behavior of the universe, so they postulate the existence of "an invisible Dark Matter"
Alright, the distinction between dark matter and dark energy are outside my expertise so I guess you win that point.
*that's actually a really terrible reason to say your argument is any good.

They can't explain the accelerated expansion of the universe, so they postulate the existence of "an invisible Dark Energy".
Actually space is expanding rather than the things in it moving outwards and I'm not aware of any equations that say the expansion of space should require energy input so I don't understand that one either.

They can't meld together General Relativity and Quantum Mechanics, so they postulate the existence of "invisible hidden dimensions and vibrating strings".
POSTULATE does not equal STATE. They're saying maybe there are strings and saying generally where to look to find out, but not that is even something you should have heavy expectations of.

And they WILL be wrong. Not necessarily entirely wrong and even right in general but when we actually get a chance to look it's not going to 100% match their expectations through and through.

How is what I'm doing any different?
Well basically you're attacking one view with the implication that if it is wrong yours is the only alternative and when things are different from what you thought you... you don't even acknowledge it, you just edit it out.

We can't explain how this universe can have the obvious order that it has so I postulate the existence of "an invisible designer"
Exactly what do you think things would look like without a creator involved?

How is this any different from postulating invisible Dark Matter, Dark Energy, Hidden Dimensions, and Strings that are so small that the current mathematics of Quantum Mechanics that totally forbids them to even exist much less be observed. spock

Stings need to be far smaller than Planck's Constant. But Quantum Mechanics is founded on the very idea that Planck's Constant is the smallest that anything can be. If we can detect anything smaller than Planck's Constant we will have successfully proven that Quantum Mechanics is WRONG.
That's talking about energy, not sizes.

But what's so bad about proving old ideas didn't te the whole story anyway?

Yet, here scientists are, postulating the existence of "invisible things" that their own theory of Quantum Mechanics forbids. laugh

So how is my postulate of the existence of an "invisible designer" because we observe design in the universe,

If we observe the effect something has it's not entirely invisible.

So tell me what there is that makes the designer not invisible. I tore up the questions you had before, have you got anything else?

any different from their many postulates of "invisible things" to explain the observed behavior that they can't explain otherwise? spock

Wouldn't that be rather hypocritical of a scientist to suggest that I shouldn't do what mainstream science does on a regular basis? huh
I'd be much happier with your doing it if you understood it.

Abra wrote:

Moreover, your example of an "invisible anything" is a bogus example, and quite misleading. Something that has no observable qualities requires no explanation at all. To even talk about such a thing would be a farce.


Shoku replies:

I quite agree. Do you think the designer of our universe has any observable qualities?


No, and I haven't described any either.
You sure keep saying that we can see the design a whole lot.

Ok, maybe this will help. You can't see wind but if your laundry is hanging out to dry you can see the wind push it. We thinks of seeing wind as seeing everything in it's path bend or fall over it the direction the wind is blowing. Show me that stuff for your designer.

However, compare this with String Theory! Which is mainstream science!

They have not only hypotheses the existence of strings to explain what they can't explain, but they have describe 7 additional hidden dimensions required for these string to wiggle in. They are assigning properties to the stings such as size and vibrations attributes etc. So they not only postulate these invisible things, but they are claiming to described precisely what they must be like.
Yep, string theory doesn't fit Occam's razor so it's not a default. If we observed those seven dimensions and they had the properties they should have according to string theory then maybe it would end up the simplest explanation but right now it really is just a popular guess people are excited about finding evidence for or against.

I haven't gone anywhere near that far.
You've said there's unnatural order to EVERYTHING and thrown in an extra consciousness (or several) for that to wiggle in.

All I've done is conclude that there must be a designer.
CONCLUDE does not equal POSTULATE.

I haven't even attempted to say anything about what the designer might be like. Wux thinks the designer whistles through his nose and has smelly feet. But, in truth, I think that's just because wux isn't pleased with the design. :wink:

I don't say anything about the designer at all.
And cosmologists[/russia] say anything about what dark matter or energy are like? This isn't holding up sir.

So I'm nowhere near as bad as the scientists who have spent all our TAX MONEY on designing invisible strings just because they can't figure out how to get their mathematics of General Relativity to match up with their mathematics of Quantum Mechanics. ohwell

And you accuse me of doing silly things? slaphead
Well yes, and you incessant lol'ing at me with so many emoticons doesn't help the case for you wanting to be taken seriously.

Abra wrote:

However, the universe is the object in question and it's hardly 'invisible', it has plenty of observables that need to be explained.


Skoku replied:

Does the explanation get to be "an invisible unicorn did it" or do we need to observe some indication of it before we can claim it as the cause of things?


Well, again, this is just a rehash of what was already said.

Have scientists observed Dark Matter?

Have scientists observed Dark Energy?

Have scientists observed Strings?

Have scientists observed "hidden invisible dimensions"?

If not, then why are you jumping on me?
I think I've made it obvious enough by now.

Jump on the scientists for a while! laugh
Oh I hate the excuse the early rapid inflation. "It's too similar" means what? Too similar on what basis? People say the "stuff" would have to have been much closer to be so similar but wasn't it supposed to have basically been right on top of the same point at the start anyway?

*I understand that it probably matters if things were close before or after the universe went transparent and atoms being present and so forth but I've never had an official explanation of what exactly the reason for that is, just the watered down Discovery channel special explanations that don't really tell you squat about physics.

In fact, they still haven't observed a lone quark. And according to that theory they never will because it's impossible for a lone quark to even exist by itself according to the theory. Yet they still believe in quarks. Because believing in their existence "explains something".
We've split atoms and made the quarks recombine into other particles. Not good enough?

Abra wrote:

Going back to the previous quote above, "happenstance" does not explain the observables that we see.


Shoku wrote:

Ya, happenstance is a f___ing mongoloid explanation for things. Only an brain dead idiot would say it was happenstance.


Well if it wasn't happenstance then what else would it be? spock
Naturalistic causes. Check out every field of science if you'd like to see what some of them look like.

And please stop asking questions I've already answered. Leading things in circles would be alright if you were ritical of my answers but you seem to just ignore them and chop them out of these replies.
Shoku wrote:

Luckily the naturalistic explanation is nearly as different from happenstance as the designer explanation.


What are you talking about now. The process of biological evolution on Earth? After the fact that atoms had already been designed? huh

Only "evidence" I've seen for atoms being designed was your claim that there are 100 specific ones. There aren't 100 specific ones, plain and simple. What other "evidence" have you got of atoms being designed?

What "naturalistic explanation"? What's natural? A universe filled with atoms that can combine to build themselves into self-programming biological robots?
Any reason that shouldn't be?

What makes that a "natural process" other than the observation that this universe can do it with ease? It's only "natural" with respect to the fact that this universe is already equipped with precisely the correct 100 atoms that accomplish this miraculous feat!
It has infinity types of atoms. Some of them split faster than others but you DO NOT HAVE ONE HUNDRED.

So what does "natural" even mean in this context? huh

You're already long past the "Creation" of this universe! That happened way back at the Big Bang, remember? If there's an intelligent designer, the design was already a done deal way back then. So anything that's unfolding now, only appears to be a "natural process" because it's already following a design!

Nice claim. It would be nicer to just postulate it instead of trying to make it the default option but it would be even nicer if you would give some evidence of it.

Abra wrote:

I fully understand all of those processes. I fully understand the theory of evolution and I don't argue with it one iota. Don't kid yourself.


Shoku replied:

Describe it then.


Well, I can only describe it based on what is known. First let me address what we don't yet know.

We don't know what it takes to get DNA off and running. We don't know what the "boot-strap" nucleotide sequence is that is required to get DNA to become a self-programming molecule. All we know at this point is that it clearly has the ability to do this.
Actually no, it doesn't.
RNA has the ability as it folds into ribosomes (and if you know jack squat about DNA you know the roles those serve,) and it folds into little units that match up to other RNA with a ribosome to stick amino acids together. Amino acids do all of the work in cells RNA doesn't and DNA came after that combo.

How does it do it after the "boot-strap" sequence begins?

Well, that's pretty simple. Even human programmers could potentially write self-programming programs. I wrote one myself at one time. I confess that it wasn't very good and it ended up crashing. laugh

In fact, that even begs the question of a designer even more. Not only was the boot-strap DNA sequence good enough to start a self-programming program, but it was a good enough program to not end up crashing!
So programmers make programs that crash. This program doesn't crash.
A: no programmer did it.
B: Scratch out A like it isn't even an option and say that it's just a really good programmer.

Well, we know which option you chose.

Based on our current knowledge, only ONE DNA program has survived. The people at the Human Genome Project believe that all life came from a single boot-strap event. They conclude this because all living beings on planet Earth share a large quantity of DNA which implies that they all came from the same original "program".
No, having all of the proteins and RNA configured to read the DNA the same way and having the same chains of reactions set up in our cells are huge parts of it too.

That may or may not be true. It could be that there is only ONE possible boot-strap sequence that can get DNA off and running.
There's not just one. Even of the amino acids we do use in most cases only four classes they fall into matter and you can interchange any of them within those classes for a protein that will have the same function. And with RNA there are only 4 options to begin with.

And that single boot-strap sequence forces the program to start out in a particular direction. This would force every DNA program to unfold in the same way at the beginning of the program. Thus resulting in any thing that starts off using DNA to have identical DNA up to a certain point before it can begin to diverge from the boot-strap program.

Moreover, if the boot-strap sequence truly is happenstance, and there are more than one possible boot-strap sequence, then we'd expect to see "crashed DNA programs".
Actually we see that a lot- sort of. With C+ and similar languages you should know that they crash about as soon as anything abnormal happens but with Java it tries to keep going and just shrug off the errors. Life falls somewhere in between.

In other words, we'd expect to see life that had died out yet had entirely different DNA sequences from all other life on Earth.
How would we see that? DNA is relatively durable compared to RNA and proteins but even just a few million years and it degrades pretty heavily. How the hell would we still have any from almost four billion years ago?

Or did you completely ignore when I explained why we wouldn't see any programs pop up after our planet already had one going?

But according to the Human Genome Project we don't see that. There is only one DNA sequence that worked. Either it all came from one instance of a single happenstance boot-strap program. Or it came from many happenstance events of the same boot-strap sequence that basically produces the same program even if it start independently.
So you understand that early bacteria would eat the materials it takes for abiogenesis right? And you understand how without the materials you couldn't get a second one popping up right?
And did you catch where I said we could have had lots pop up but before switching to DNA they fused together in a variety of ways?

Well with you bringing that stuff up you obviously didn't so thank you for reading what I say. I'm so glad you value my input -_-;

In any case, getting back to you're question. Once this boot-strap program is up and running, then the process of what you call "natural selection" can take over. But not before.
Actually yes before. Looks like you didn't read where I talked about membranes and making copies of RNA and proteins either.

So to look at more advance living creatures and say, "Look! It's a process of natural selection of survival of the fittest", totally misses the original point of how unnatural the original boot-strap event of creating such a self-programming organism was to start with!
Yes, it would miss it. Good thing I went to all that effort going into the origin of life that you didn't read.

You're already passed the real miracle!

I can see now you're one of those goalpost movers. The "real miracle" is whatever step you think the person you're talking to can't explain. If they do, well, you can move it back to whatever else they can't explain.

Any so-called "explanation of creation" at that point is just a description of how the program runs after it's already up and running. It's meaningless at that point.
If your view was default sure. It's not.

That's not an "explanation" at all. That's just an observation of what happens after the miracle has already occurred!

At that point it's only a "natural process" because you've already assumed a self-programming molecule as a "natural event".

You're already past the actual "Creation of Life". All you're doing at that point is describing what life does.

That's no explanation!

That's like telling God, "You get life started, and I'll explain how it works". laugh

No, that doesn't work. You need to explain how life could get started! And why the atoms in this universe allow for such an "unnatural event".
Survival of the fittest. You can do math can't you? n_n

And I'm allowed to call that an "unnatural event" because the only thing that makes it "natural" is the simple observation that this universe does it!

That's the only justification for calling it a "natural event". ohwell
You don't listen very well. I've already given other justifications for it. I'd give more but I'm going to wait until I think you can be trusted to actually read my posts in a way that you comprehend some of what I say.

Shoku's photo
Sat 11/07/09 07:35 AM

our universe is older than what scientist believe it is. its infinite and thats that. quasars are the developement of galaxies not destroyers by the way:smile:

But things are moving in straight lines away from us. If we check out the speed and turn the clock back we find that 14 billion years ago everything would have been right on top of us.

And quasars are supermassive black holes at the centers of galaxies. Most or all galaxies have them but in a quasar there's a lot of gas being sucked in and that gas rubs against itself until friction gets it so hot that it's that bright. You can see the same kind of thing happen in the formation of any star but at lower temperatures and thus lower brightness.

Abra:
Creative wrote:

If there is a hypothesis which cannot be falsified through observation it is useless and discarded. Such a hypothesis is not worth the paper it is written on.


laugh laugh laugh

Better not say that too loud, the String Theorists might hear you!

laugh laugh laugh

You don't want to interrupt Science in Progress do you?

laugh laugh laugh

Oh that stuff is falsifiable. They're making predictions left and right, it's just going to take some time before we can look at anything big or small enough to really check.

You know big bang? With everything being dense gas that got less dense that means there should be background noise everywhere at a small value. The guy who did the math didn't get a chance to check but eventually two radio workers did and for finding it they got one of those Nobel prizes.

After we've got stuff like the Higgs Boson out of the way we can maybe make some giant contraption to work on something very string specific.

Peterpan:


Somebody HAS to agree with your alleged 'proof' before you can call it "proof."

Proof is a matter of agreement.




I disagree, proof is the revelation of truth, whether someone else agrees or not. Otherwise the proof of inteligent design is in the Bible.
The same with reality, perception does not denote reality. It does not matter if 2000 people say there are 10,000 blades of grass in a square foot. One blade hidden behind another and not perceived does not change reality, it just shows that we can't perceive it.

Abra makes alot of good points which alot of people agree with, yet nobody will admit that it's proof. What happens when we discover what quarks are made up of? What if our world boils down to binary code?

Before anyone can see proof, they must first admit to the possibilty that there may be proof. Until each side can concede that fact, this discussion is pointless.

The folk against abra and the rest around here are willing to accept proof but we're got certain standard criteria (mostly dating back to ancient Greek philosophy,) so some things are a no go.

"I don't understand how there could possibly not be a designer" isn't proof. I've explained a few fallacies to no avail before but if anyone doesn't understand why that's bad just look up argument from ignorance.

JB



Somebody HAS to agree with your alleged 'proof' before you can call it "proof."

Proof is a matter of agreement.




I disagree, proof is the revelation of truth, whether someone else agrees or not. Otherwise the proof of inteligent design is in the Bible.
The same with reality, perception does not denote reality. It does does matter if 2000 people say there are 10,000 blades of grass in a square foot. One blade hidden behind another and not perceived does not change reality, it just shows that we can't perceive it.

Abra makes alot of good points which alot of people agree with, yet nobody will admit that it's proof. What happens when we discover what quarks are made up of? What if our world boils down to binary code?

Before anyone can see proof, they must first admit to the possibilty that there may be proof. Until each side can concede that fact, this discussion is pointless.


A revelation of 'truth' has to be realized by an individual or individuals... then agreed upon.

Therefore proof depends upon that individual or individuals being able to believe and understand that revelation.

As far as your Bible example, I have never met anyone who agreed on everything written in the Bible, so that is a bad example.


There are things where if you disagree you're just wrong. If you disagree that the number four comes after the number three (only integers) the system of mathematics doesn't care. If you refuse to count higher than 12 and there are thirteen eggs on the table disagreeing with anyone about how many eggs there are does not change how many eggs there are and your view of twelve is inferior to their view of thirteen.

...If you say there is the magically whole number of 100 atoms but anyone who knows better points out that there are 92 stable atoms and infinite isomers...

Peterpan


A revelation of 'truth' has to be realized by an individual or individuals... then agreed upon.

Therefore proof depends upon that individual or individuals being able to believe and understand that revelation.

As far as your Bible example, I have never met anyone who agreed on everything written in the Bible, so that is a bad example.




You said proof is a matter of agreement (again). What else is more agreed upon than the creation of the earth and the great flood?
Forget about the Bible, that doesn't matter. I figured I'd show how "agreement" can turn around and bite you on the arse.

At least you agree that proof depends on an individual being able to believe and understand. (understanding is not neccesary imo)

I'd be more than willing to accept any truth as proof if it can be shown. As we stand, evolution has none. There is much more evidence of intelligent design than accidental "happenstance".
Even dating techniques are fallable. All matter is at least as old as the universe according to physics.

And if "we" are the designers, who designed us? Are we "self-realised"?

Evolution is defined (within the actual field) as the change in the frequency of alleles in a population over time. You can flat out watch that happen.

I suspect that by evolution you mean "everything from big bang to the origin of man" as if it's some kind of rival religion of Christianity.
Shame on you. That's a nasty nasty scarecrow argument~



Peter Pan wrote:
I'd be more than willing to accept any truth as proof if it can be shown. As we stand, evolution has none.


That's funny. laugh


Let me rephrase that... Macroevolution has none....
Oh boy...
Well,
http://www.talkorigins.org/faqs/comdesc/
http://www.talkorigins.org/faqs/homs/
http://www.talkorigins.org/faqs/kansas/kangaroo.html
http://www.talkorigins.org/faqs/genetic-drift.html
http://www.talkorigins.org/faqs/thermo/probability.html
http://www.talkorigins.org/faqs/wells/haeckel.html
http://www.don-lindsay-archive.org/creation/eye.html

And with some of the basics out of the way:
http://www.sciencemag.org/cgi/content/abstract/221/4609/459
http://www.nature.com/nature/journal/v336/n6198/abs/336435a0.html
http://www.pnas.org/content/100/13/7527.full?sid=7ac1fa86-58b5-49ea-ab32-74195cec1442
http://www.pnas.org/content/101/9/3077.full?sid=63d56eb2-1b42-4e2c-85df-bdbf76df6e23
http://www.gate.net/~rwms/EvoMutations.html
http://www.uni-muenster.de/Evolution.ebb/Teaching/courses/tut/ws0607/papers/roossinck-symbiosis-competition-plant-virus-evolution-NRM-05.pdf
http://linkinghub.elsevier.com/retrieve/pii/S0960982204004464

I have hundreds more available but I didn't want it to look like I was just bombarding you with more information that you could possbily be expected to go through in a month.

Shoku's photo
Fri 11/06/09 08:54 PM

Di wrote:

QUESTION FOR ABRA:

When looking into creating a hypothesis for an inelligent design theory how would we decide whether to look for a single force capable of willing matter into being, or a programmer geek type god who created a matrix type game comeplete with humans for role playing? Or perhaps we should look for a complex energy source formed by a combination of free agents that decided to build a matrix through which to recreate their essence in various physical forms for the pure enjoyment of experiencing such forms?

How would you proceed, as a scientist, I mean?


Well, for starters I wouldn't be looking for the actual designer. As far as I'm concerned that would be futile for the following reasons:

1. If the designer wanted to be revealed we'd know it. laugh
No. If God wanted to be revealed we'd know. There are lot of reasons other possible designers would be limited in action.

The designer would just reveal itself. So clearly if there is a designer, that designer either can't, or won't reveal itself.

If we are the designer, that explains why the designer is not revealing itself. It's a game where the designer gets lost in the game until it FINDS itself. So revealing itself to itself would be counter-productive to the very nature of the game.
That's an awfully limited number of ways we could be the designers. Why couldn't we have designed this without knowing we were doing it do example?

2. It is my understanding from the mathematics of Quantum Mechanics that certain knowledge exists that is physically beyond our reach.
That or cause and effect aren't quite so definite as we wish they were.

The mathematics of QM demands that we cannot know certain things.
Not so much the math. The trouble is that when a photon hits something and bounces back it nudges it a little bit. Thanks to this if we figure out how fast something was going we moved it around enough that we don't know where it was and if we figure out where it was we bumped it enough that we don't know how fast it was going.

And this isn't because we're not clever enough. It's because this is the nature of physicality. As long as we are in physical form there are certain things about the nature of the quantum field that we can never possibly know, no matter how sophisticated we get.
Non-particle based information gathering might not be impossible in our physical forms. If you accept psychics and things they can't be doing what they do with everyday particles and the exotic ones usually wouldn't interact with our matter much anyway, much less whatever they wanted to get information from.

It's forbidden by the mathematics. Period amen.

So either Quantum Mechanics is wrong, or certain information has been forever 'hidden' from us.
Or it's not information at all. Things like radioactive decay happen in statistically predictable ways but the decay of a single atom doesn't even have quantum causes behind it. If you want to talk quantum physics you need to accept that decay as an effect without a cause.

If there is an Intelligent Designer, then it makes sense to take that as an act of the Intelligent Designer to purposeful forbid us from discovering its darkest secrets.
The hell? We can still find out any particular thing, just not certain combinations and other than stuff like the "let's try to make ultra-identical twins" scenarios knowing all of that wouldn't have much practical use anyway.

So we're left with having to be satisfied with just finding evidence of a designer.
So if the designer wanted to be revealed it would but instead we have to settles for the stuff that... uh, reveals it? What? You're not even making sense.

1. My first goal would be:

Look at the system and see if happenstance explains it.

If it explains it then I'm done and I don't even need to consider an Intelligent Designer.

So I do that. I'm not happy at all with happenstance as an explanation.

And there are people in here that aren't happy with you having free speech but that doesn't have any impact on your having it or not.

Happenstance doesn't explain what I see. To believe this universe is happenstance would be far more outrageous then accepting that the Mona Lisa had been created by a garbage truck splashing mud on a canvass by driving through a mud puddle.
Well ya, mud doesn't contain the green and red pigments you see in that and probably wouldn't do a good job of the blue ones either.

Meanwhile non-life has all of the "pigments" and once you get certain combinations of them they go making more of themselves.

It's not a suitable explanation.

2. My second goal would be to make that result more meaningful

I've already explained in detail why it's unrealistic to think that only 100 random happenstance elements should just accidently do all the things that elements do in this universe.
I know I've been a day or two behind in this but I'm pretty sure my post where I explained that you were wrong about there only being 100 was before this.

Particularly building themselves into conscious sentient beings.


3. My third goal, would be to look more closely at that DNA programming, particular the "Boot-strap-loader"!

I don't know if you're familiar with what that is, but no computer program can run without one. DNA necessarily must have a "Boot-strap-loading" sequence. That would be my third goal. To study that boot-strap loader in extreme detail.

Unfortunately I don't believe that even the Human Genome Program has a clue where that particular DNA sequence is yet. But I would love to study that baby!
CAGGACGGACAACATGTCAGAGCTAGCTACCATGCATAGC
Doesn't mean squat to you does it? Picture that stretching on for hundreds of thousands of letters.

That's precisely where I'd go.

I'm sure they'll find it eventually and when they do that's going to be an extremely exciting time in genetics.

Unfortunately, they'll probably just say, "Look! We found the boot-strap-loading sequence! No need for any God!" laugh

What a bunch of idiots if they do that! whoa

There is so much information that can be had from that little piece of code. That would be GOLD! I'd love to get my hands on that little strip of DNA. What a book that would be! No matter how small it is, the information contained in that boot-strap-loader will be enormous.
Well no. You can fit all of the information of what parts of your DNA make you onto a standard CD.

That would be the information that the designers programmed in by hand! "so-to-speak"
You've been arguing that it was all programed by hand starting from molecules and going up to the highest degree of interaction you comprehend.

But it's nice to finally get a formal irreducible complexity claim from you. I know that recognition of the simple steps leading up to what you're looking for wouldn't sway you in the slightest but it would disprove your claim by all reasonable standards.


And one last question - in case your theory hits dead end, what is your "default" - as a scientist that is?


As a scientist I have no "default". If I don't know something I just say so.

Agnostic ring a bell? bigsmile

That's exactly where I'm at right now.
Agnostic my ***. If that's what you were you wouldn't be dismissing non-designer views as happenstance. You'd have to be saying that happenstance and designer seemed equally likely and that you couldn't pick one, or better yet not calling it happenstance at all and addressing the actual view.

Although, I confess that I lean toward a designer because as far as I can see that's where the evidence is pointing.

Give me that little DNA boot-strap loader and I'll tell you volumes about the Intelligent Designer. bigsmile
It's called tRNA. Look it up.

Shoku's photo
Fri 11/06/09 03:18 PM
Edited by Shoku on Fri 11/06/09 03:32 PM
Sky:
Sky seems to be more of the first variety with some "reality is imaginary" solipsism thrown in.
I could see a tiny bit of what you said, previous to this, that had some relation to my beliefs. But I think it’s mostly out of context and thus much of my intended meaning is lost – particularly the “real is imaginary solipsism” part.
No, that's definitely solipsism. The other words were just there so people would know what I was referring to because I felt I should prime people's vocabulary to make sure they knew what that word meant.

So we do not yet have agreement as to what constitutes “disorder”.
No, I'm letting you use your definition. It's meaningless…
Yeah, that’s what I said. My definition is meaningless to you. But since you have not offered any definition at all, I don’t see any meaning coming from you either.
You're right, I've only said that legos built up as a castle would be order and legos scattered when a club hit that castle should be disorder. How could you ever find the implicit definition in that?

But you seem to be saying that what I consider to be disorder is irrelevant and only your view on disorder is valid.
If disorder does not exist anywhere you're using a word with a meaning but that meaning has nothing to do with anything in our universe so it's pointless to say anything about it.
And again, since you have offered no other meaning, my meaning stands because no other alternative has been offered. In the vernacular, put up or shut up.Thermodynamics for 200.

So can you give me words that describe the difference between a castle built out of legos and legos scattered about all over the place from what was basically just un-aimed destructive force?
Yes I can. But I don’t see any reason to. I’m not interested in a discussion where the only action is tearing down others views with no apparent interest in building up any mutual understanding.

You cause people to respond to you like this. The ideas you express only start people questioning you but it's the way you interact that makes everyone so hostile.

Importantly, this means nobody came here with the interest of tearing you down.

JB:
If you do not feel the need to prove what you say maybe debating is not for you?? Belief or otherwise.

There are cases where proof speaks for itself without any agreement from both sides. This should definitely be one of those cases. Because a designer would be very obvious if it existed.


No there are not. The 'proof' never 'speaks for itself' no matter what it is. It still requires agreement.

Designers are very obvious. I have given you examples. Now tell me why (to you) they are "not obvious" or (to you) they are not "evidence enough."

Instead of just making blatant assertions, tell my WHY you make these statements.

As far as 'debating' not being for me, I say again Proof is a matter of agreement.

If you are 'debating' and protecting your position with no intention of listening to the other side or looking at the evidence, then you are correct. That kind of 'debating' is not for me. I seek to find agreement, not to 'win a debate."

When you learn about the history of which scientists discovered which things you hear about a lot of people that hated each other. They disagree entirely because they're so disgusted by each other and they can't even stand to be in the same room (sometimes even when it's an auditorium,) but even in that situation one can gather up evidence for their work and the proof does it's work.

People disagreed with Columbus about it being possible to sail to another continent through the Atlantic but he went and did it and then made several return trips. He gave proof and then afterward people agreed, not the other way around.

Abra:
On a more atheistic side of things, let's assume that there is no intelligent designer.

This converstation and hypotheses still has much worth. In thinking about how intelligent design might be discovered or proven to be the case, I've been able to show that there is indeed evidence that points in that direction that is worthy of further investigation.
Like hell you have. You've been able to show that you don't understand many of the physical sciences or logic fallacies.

Also, from having engaged in this thread I've been stimulated to think of quite a few ideas concerning DNA and the human genome. Or I should say the Earthy Genome since the questions I have would apply to the DNA of every living thing on Earth.
DNA is a relatively arbitrary information molecule. Non-Earth life could very well use other carbon chain molecules for the same purpose, though relatively small and stable ones should have an advantage for obvious reasons.

The human genome project currently holds that all life on earth came from a single common cell.
Well I think I can rule out you being a biology teacher. The human genome project was a particular venture to sequence only the DNA of humans that took 14 years to complete but helped to drive advancements in DNA sequencing machines.

Genetics in general support the universal common ancestor concept though with more recent understanding of how much less distinct the species boundary was early on the tree of life has what resembles, slightly, roots. From DNA it's not possible to say that the original cell arose only once as the common ancestor itself may be have been a chimera of chemical products.
But presuming it did just happen once there was basically some incest in the family tree, though be careful to understand that context as at this point there would not have been sexual reproduction yet.

Their reasoning actually stems from the fact that every living thing they can find shares about 25% of the human genome.
That's a really inaccurate statistic. People have been saying that before the human genome project (and as we sequenced the full genomes of humans first we would have only had certain viruses and bacteria to compare it to. Currently we've sequenced most or the things we regularly eat and several species of interest.

But this is easily misleading. Sequencing a full genome is still expensive so a great array of techniques for picking out particular stretches to sequence. Often months and months of narrowing it down are preferable to paying the fee to sequence a large chunk of DNA.

Your statistic is most likely referring to mitochondrial DNA but who knows how many steps of the telephone game it could have gone through before you heard it.

Now, we do share surprising details with things even so different as bacteria. The general trend is that proteins inside of the cell are very nearly identical but plants, animals, and fungus (and some things I'm not going to explain,) have their major differences in proteins that stick through the membrane, which happens to be how cells communicate between each other. The same chains of interactions are there but the first step that sets them off is in the membrane for us so other cells can control it.

In other words, everything on Earth basically has the same DNA save for changes that have evolved only after the DNA had already become quite sophisticated.

It dawned on me as soon as I heard this, that this isn't the only plausible exlanation. A second explanation could be that no matter when or where DNA starts up, it always starts up with the same "boot-strap" program. And that program could be responsible for all creatures that have DNA to have very similar starting sequences.
That would be a good reason but it's clear you don't know the chemistry. There are hundreds of amino acids of varying types but we use only a particular set of 21. There are a few microorganisms that have a single change in their genetic code that uses a different amino acid and it works. It could work for us but we just don't use it.

Likewise there is a whole lot of other chemical setups that we COULD use but don't. There were lots of other chemicals available to us but much like a racing car you can't tack on every option there is if you want it to go fast; you've got to streamline things.
And some early cells did and we're all descended from them.

In fact, I've actually been quite interested in this question for some time now. Because, for me, the difference between these two scnearios is humongous.
If you want chemistry tutoring I can go into tons more detail~

If all life evolved from a single cell, like the human genome project holds, then life is very rare at getting started indeed.
Not at all. It could take thousands or millions of years for nonliving material to make all the parts for proto-cells but something like a bacteria- well those can divide in an hour if conditions are about as harsh as they can possibly handle and if you keep doubling like that you get billions of cells in just two days. Think how fast those would get into just about every corner and crevasse and you can see how they'd get everywhere and gobble up all the organic material to make more of themselves in the blink of an eye compared to how long it would take a second early cell to form.

Once there is anything to compete with abiogenesis doesn't have a snowballs chance in hell but if left alone for a million years it might happen practically everywhere it possible could.

On the other hand, if my hypothesis should happen to turn out to be true, then life may have started evolving in many different places quite easily. It just all looks similar because the only permissible "Boot-strap" program sequence automatically demands that it proceeds along a certain path before it can begin to diverge.

I'm sure that the Human Genome project will eventually get down to this boot-strap program. Potentially in as little as the next 20 years!
Inaccuracies aside that's pretty good. We've actually got the tools to start on it now and there are several people working on making a cell from scratch (to varying degrees,) but sadly, they probably won't get full results this decade.
But hey, you've got to start somewhere if you ever want to figure out how things work.

It's going to be extremely interesting. So many questions!

Is there only one possible boot-strap sequence?

Is there more than one? If so, how many?
For life like ours you need something like 30 genes to have a chance to function (based on comparing bacteria.) After we've worked that out in full detail (or close,) people will be able to realistically work on actual "from scratch" systems to accomplish the same thing.

Where do these boot-strap sequences 'send' the DNA (in terms of self-programming). In other words, if you could get two of these things started with the same boot-strap sequence, at what point would they begin to diverge?
Immediately. Mutations aren't programmed into the DNA, they happen with external conditions. Different sunlight, chemical intake, temperature differences (and really just about anything) can cause them and it's effectively impossible to put two copies in so identical an environment.
(Plus background radioactive decay isn't something we can any control over so we'd need whole other ways to make things "identical.")

You know how kids have a 50/50 chance of being a boy or girl? It's like that. If you had two identical sperm fertilize and egg you'd get the same gender child but you couldn't ever make the whole sex act so identical to definitely get that same result. Single parts in a test tube or petri dish and sure, you can control which will happen but as you add factors in it gets much harder to control.

How many neucleotides down the road before they could begin to diverge?
Well with sexual reproduction "diverge" refers to when the immune system makes the fusion of sperm and egg impossible but the lines are fuzzier with asexual reproducers.

These are fascinating questions.

And for me, they are even more facinating in terms of the programmer.

What was the programmer thinking who designed this molecule?

It's amazing what you can learn about a person from the way they program a computer. I used to teach computer programming at one point and let me tell you. You could give me a program that one of my students wrote and I could instantly tell you which student wrote the code.
I know all about that n_n
But is that the "science" you taught?

I would love to see this boot-strap program for the DNA molecule.

That would indeed be looking right at the "handwriting" of the creator of this universe.

I'm truly becoming so totally convinced of Intelligent Design that it doesn't even make any sense to pretend otherwise (even to myself).

The idea that DNA just happened by accident to be a self-programming molecule that could not only perform this self-programming task, but also have everything it takes to store that program, unfold it when it needs it, and not easily deteriorate!

My God! It would have been a miracle just to flimsy DNA to be able to become self-programming by pure happenstance. But to be able to not only be the program, but to be the 'hard-drive' TOO! And to be able to fold up and unfold as needed to expose just the right sub-rountines at just the right times? spock
Well if you want to think of it like that the deoxyribose backbone is the hard drive and the nucleotides are the program.

It's important to recognize that all of the parts that translate the program are like the programming language- DNA alone is just like a meaningless string of 1s and 0s if you don't have the right stuff to decode it.

-and like I said with JB, these aren't perfect comparisons. These are the closest I can compare and hopefully you get the general idea from it.

All that just happend by pure random accident?

I don't think so.

Someone designed that molecule and all the nucleotides that make it up. Someone designed these atoms. They aren't just happenstance.
So basically your evidence is "it seems crazy to me"? Of course new information doesn't sound like it makes sense in your understanding of the world- it's new. People thought the Earth going around the Sun instead of the other way around was too crazy to be true but they kept looking and people became familiar with more of the details and eventually people realized "ok, the way we thought it worked was too crazy to actually be it." (In particular the geocentric model with epicycles was wrecked but moons orbiting Jupiter and Shadows on the face of Venus ((sometimes it had to be closer than the Sun and sometimes further,) but these weren't absolute proof; it's just that that was the point where people understood well enough to recognize how much they would really have to do to make the geocentric model really work.)

That's crazy.
That's not a valid argument. Sorry but anybody acquainted with fallacies knows not to accept arguments from ignorance or ridicule.

I designed enough stuff in my life to know that there are far too many things that would need to come together for this to have just been a freak accident.

This universe was definitely DESIGNED.
So basically you're saying it is irreducibly complex? That argument was shot down back in Kansas.

As far as I'm concerned DNA itself is the all the proof anyone should need. I'm really in shock that scientists are still pretending that this could have happened by pure random chance.

It has nothing to so with TIME, or how long DNA had to 'evolve'. It's the simple fact that it CAN DO IT that should be all the evidence that's needed.
I don't see the connection. Why shouldn't the results of the big bang act this way without a designer behind it? Seems like most of it is just the simple math of "things that happen more often are the ones you will see the most of."

Any time factors are totally irrelevant.

This universe was designed.
Again, why? What's the limit of what things without design should be able to do? Why is that the limit? If you've designed so many things why not say that too few things have gone wrong for it to be designed?

Shoku's photo
Fri 11/06/09 06:18 AM
Abra
Dragoness wrote:

So that should be the challenge, if you believe in intelligent design, where/what/who is the origin of the designer/s?


If you believe in the orderly laws of physics then where/what/who is the origin of them?

What's the difference? Either way we're stuck with having to guess.

So any guess is just as good as any other.

That's the real point!

No guess holds any more merit than any other guess.



What's the difference? Either way we're stuck with having to guess.


What's the difference?


Thank you for admitting that throwing a designer into a mix doesn't make the origin of life in our universe any less of a random chance to you. I can't understand for the life of me why you care less about the infinitely improbable spontaneous origin of some god than you do about the apparently moderately probably origin of our universe and life within it.

Your argument has been that this is all too complex to have been the results of chance but some God that sets up such a complicated universe would be even more complex than that.
And if you don't think so you shoot yourself in the foot because you're admitting simple things can lead to complex things and an admission like that dispels any notion that you would need design for our universe to turn out like this.

No guess holds any more merit than any other guess.
Should I talk about more space polar bears trying to control our bladders or are you just never going to get that some guesses hold a lot less merit than others?

Dragoness:

LOL, that did not answer anything.

My mind doesn't need mind altering drugs to expand...lol People fool themselves into believing that drugs help them in this area...lol

Personally my brain chemistry is just wonky enough that I've experienced those things without drugs.

Luckily it's also stable enough that I can tell them apart from reality. Tripping out doesn't seem to really give me experiences that seem remotely spiritual in the first place though so it might be easier because of that.

JB:


Have you ever seen the Movie "Contact" staring Jodie Foster?

Your answer about the designers is in that movie.

You can expand your consciousness without drugs, but if you can't do that, you can use drugs. I personally would not use drugs.


No it's not, even the designers in that movie did not know who the designers of them were...lol They said it was just the way it had always been done.


They did not know who the ultimate designer was. The first. But their designers were the same as they are. They also did not know who the ultimate designer is. ...and so on.

That my dear, is the nature of the universe and of infinity.

Infinity is the key. Nobody understands that. Sorry. I can't help you there. :wink:

INFINITY IS THE KEY.

Actually that's one of the first things people hear when they look at these topics. The idea was basically dropped when we realized that time didn't stretch eternally backwards and that our universe had a point where there couldn't have even been planets for life to be on.

Redy:
Sky wrote:
I look at the game as being a MMORPG (Massively Multiplayer Online Role Playing Game). That is, the game is played by multiple players who can interact with each other – according to the game’s programmed instructions/design specification.

Now as to whether the game was designed and created through a collaborative effort that included all the players. Or whether it was created by a small group (or single entity) and others just “joined in” is really irrrelevant.

What is relevant is that there are multiple players, each of which “plays a character” who can “die”. When a character “dies”, the player simply creates a new character and “starts over”(thus the conceptr of reincarnation.)

Anyway, that’s the basic foundation of my view.


What does this have to do with science? Based on your view, what reason would you have to argue that science should accept the possibility of your creative vision? What is there to gain?

Player Skyhook
+3 exp

Level up!
mysticism: +1: 6
unrelent +1: 9
hibidyjibidies: +3: 13
logic fallacies +2: 16

Class up! Junior Disciple of the Cloud Technomage

Shoku's photo
Thu 11/05/09 08:51 AM


Abra:
On the contrary what is observed flies in the face of happenstance.

Therefore attempting to use Occam's Razor in this situation only shows that you don't even understand Occam's Razor.
If it doesn't look like chance we toss chance out and move up to the next simplest thing as the null and so on until we don't have any evidence that doesn't fit.

Occam's Razor doesn't just say, "Well, if you can't figure out just call it happenstance." laugh

I hope your not a scientist. whoa
I hope you're not a scientist whoa

You don't even seem to grasp the most fundamental ideas of even Occam's Razor.
You don't seem to grasp the fundamental concept of Occam's Razor.

Shoku wrote:

...basically think of the default as a plain cube of clay. When you see anything that says that should not be the shape you can whittle away some of the clay and if you keep looking you should eventually complete the sculpture. We are just asking that you start with the basic and then work up to the complex and tell us why you take the steps that lead you there.


Well, even if you wanted to start with the conjecture of "happenstance" as your 'cube', you'd end up with a puddle of goop by the time you look at all the evidence.
Goop shaped like what?

That's my whole point.

The conjecture (or hypothesis) of "happenstance" doesn't stand up in the face of the evidence.

It'd doesn't "explain", on the contrary it's doesn't fit the picture at all. You have to bend over backward to assume that most freakest rare happenstance event ever concocted.
I wonder if you've seen that post I made about not knowing how many sides the dice has or what numbers are on it...

That's not happenstance "explaining" anything. That's just refusing to recognize that an assumption of happenstance doesn't even begin to fit the data.

So you're arguments here aren't even close to being supported even by the very examples that you're giving.

Shoku wrote:

Again with the invisible pink unicorn: if I can't see it or feel it or touch or hear it or any sign of it how could i have become so convinced it was there in the first place?


But why are you always coming up with these 'invisible' silly ideas?
Because the designer you're supporting is invisble and silly.

We do have observable measurable evidence that strongly suggests that happenstance can't explain.

Therefore it's prefectly reasonable to consider that something other than happenstance must be in the mix.

I honestly don't care what your own personal beliefs are on this. But your reference to Occam's Razor, doesn't fit this scencario because Happenstance does not explain what we see!
Which is why something is only a null, not a supported theory. Evolution is a scientific theory. Planetary accretion, fusion, and big bang are the same. String theory is, perplexingly enough, not a scientific theory, or at least not until we've got some evidence for those strings besides "the math checks out."

Once something is a scientific theory believing differently means rejecting observed reality, unless you've got evidence that doesn't fit it.
Believing differently than the null just means you have beliefs. Until there's support for some part or another the null is just the starting point and if you're so inclined you should go find some evidence for or against it.

Occam's Razor merely says that once you've got a simple explanation that works there's no need to make it any more complex.
You understand that default doesn't mean "this is the only option" right?

But happenstance doesn't explain it in the first place. So Occam's Razor can't even be applied here.
Again, naturalism explains quite a bit if you're willing to stop trying to force it to mean "nothing but unguided luck."

Hey! If happenstance fit the data and looked like a reasonable explanation I'd jump on it myself!
Then why haven't you?

I have no agenda to do anything other than seek TRUTH.
but only in the light of God, right?

But happenstance does not explain the odds! On the contrary for this unviverse to be happenstance we'd have to assume that it's is the freakiest happenstance event we have EVER encountered!

In fact, if we accept this universe as mere 'happenstance' then why even bother with science at all? Why not just chalk up everything to happenstance? whoa
It's saying things like this that prove to me you were never a science teacher, or at least not a remotely good one.

Science and mathematics do not support happenstance as a reasonble explanation, and because of this, Occam's Razor can't even be applied.

You need to first have a reasonable explanation before you can apply Occam's Razor.
Energy flows from high concentrations to low concentrations and for one type of energy to do otherwise another type must flow even more in order to push it like that.

Can you think of many physical phenomena that don't follow that?

What you're talking about here is a gross abuse and misrepresentation of scientific ideas.
Naw, you're just abusing what I've said.

Science does not support a conclusion of happenstance.

That's just not true.
What I said was true. The problems all come when you turn it into something different.

So I guess that's one more tally for scarecrow argument. You're racking up a whole lot of fallacies here.

Shoku's photo
Thu 11/05/09 07:56 AM
Edited by Shoku on Thu 11/05/09 07:56 AM
Abra:
Shoku wrote:

It's just not a good option and lacks any reason to accept it over the null.


I told you that you were in agreement with me.

However, where you seem to be totally misguided is in the totally erroneous conclusion that 'happenstance' = null.

Null = "We don't know and can't say one way or the other"
Nope. We DO KNOW THINGS. We don't know everything but the null is the minimum we can say with what we do know. I've illustrated repeatedly that we all innately understand that it's foolish to inflate things past that.

Null does not equal support for atheism.
The null is fairly atheistic but you're right in not calling it support. It's just the reasonable stance to take when you aren't having your faith choose your stance.

That's a total abuse and misuse of science that atheists are attemtping to lay claim to.

It's a misrepresentation and it's utterly false!
You'd agree with me more if you knew what I was talking about?

Shoku wrote:

Occam's Razor gives us the default. It is not always significantly better than the alternatives but if you cannot provide any reason the alternatives are better it is not appropriate to just claim that they are.


Occam's Razor doesn't even apply here!

It can't!

Occam's Razor refers to the simplest explanation.
Yes, the null.

The reason why Occam's Razor doesn't apply here is because happenstance doesn't "explain".
Naturalism explains.

I'm going to treat you're deaf if you keep equilibrating those two terms because they have very different meanings. JB was pretty annoyed by my picking apart the psychology of her sharing her opinion and arguing for it when it wasn't asked for but what you're doing is much worse.

So basically you're saying "God is the single source of all meaning and purpose and he either created us with those things or we are just meaningless random chance and anyone who thinks differently than me doesn't get their own options because they are less that human."

Now, I've been trying to stay on the science subject here but you seem pretty fixated on atheists so: they agree with you about most things. We have a purpose, there is good in the world, you should rape kill and plunder your neighbors, etc. The thing that is different is that they say there are reasons for all of those things other than God. Those things are there, and there are reasons for them, and atheists say there's no God.

They are rejecting "God is the origin of all things good," not that there are things that are good.

...well, ok, there are the nihilists but saying they represent all atheists would be like saying the flat Earth society represents all Christians.

And so with this I am giving you one more chance to show that you are capable of empathy and some God damn human dignity. If you're still acting like naturalism can't be anything but happenstance after page 35 I guess we'll all know what kind of person you are.

Shoku's photo
Thu 11/05/09 06:03 AM

Well certainly if you name the artist as the only cause. I was assuming you meant art such as Jackson Pollack’s where he just dribbles paint on a canvas. So of course if you simply ignore all things such as air currents, adhesion of paint to brush, inertia of the brush, flow mechanics, etc., etc. then the artist is the only cause. In other words, if you purposely ignore everything but the artist, then there’s nothing left to assign cause to. But I choose to include those other factors as both “cause” and “unknown” – i.e. the exact effects of those combined causes is unpredictable.
Demostrate the logical progression which leads to the conclusion that the universe is a design... however you feel like doing it. You say I am not taking into consideration what you are. Save me the guesswork and lay it out.
I'll just restate the "short form": In those cases where the source of order is known, such order is always the direct result of purposeful intent by a designer. Therefore “order as a direct result of a designer” may reasonably be assumed in those cases where source is not known.

An example using different phenomena: Every time I see rain and sky, there are clouds. So every time I see rain but not sky, I still assume there are clouds, even though I cannot see them.
Sky, this was suppose to be a demonstration of the logical progression which leads to the conclusion that the universe is a design? I don't think it accomplished that at all.
Ok, so we think differently. I have no problem with that. I'm not saying you have to agree with my evidence, logic or conclusions. I'm only saying what works for me.
If A then B. B therefore A.

...children cry when they don't get candy. This child is crying. It couldn't possibly be a genuine medical condition and they must just be whining about candy.
...

Naw, I don't think it works. That one is the affirming the consequent fallacy by the way.

Shoku's photo
Wed 11/04/09 12:54 PM

You are right, in that my statement of "women are sensitive" is a generalization, comparable to "black people are..."

BUT, I'm telling you, women and men are wired differently. And the humor you use with your friends is PROBABLY not going to work with a woman, without toning it down some.

It is like thinking that, because you are a couple, she will like every movie you do and vice-versa. They don't call them "chick-flicks" for nothin'.
Yep, definitely different tendencies. I could turn this into an argument about if they are born wired differently or if the way our society works is what wires them like that most of the time but that would be a huge tangent.

...the humor I use with my friends...
Well thing is during high school most of my friends were girls. My sister is the only girl that sort of fits into the "friend" category that doesn't understand my humor so much, though after she married into a social group with humor like mine the tables have turned there a bit.

To be honest in most cases I'm probably too cautious about anything that might be a sensitive subject. IRL I don't joke much until I know what kinds of views someone holds, and although I don't appreciate how warren said I was mean and boring, boring is a good description until I loosen up around people. I still get described positively but "fun" is something I have to learn over with each person I meet.

I've been struggling against that for a few years and I've made significant improvement but it's hard to stay optimistic.

Shoku's photo
Wed 11/04/09 09:52 AM
Abra:
JB wrote in response to Shoku,

It sounds like you are talking about religion and politics here and that you are fighting that battle. Good for you, keep up the good work. But don't mistake me for a politician or a religious fanatic just because I see things from a spiritual point of view.


I agree.

Besides, why misrepresent science just to fight religious battles.
You mean like saying that there are only 100 atoms and that that's some kind of magical number that points to a creator?

Scarecrow arguments, arguments from ignorance, begging the question, appeals to popularity. false dilemmas and analogies, affirming the consequent, and I think I've even seen some complex questions thrown out. If I dug up my old list I could probably name a few that aren't at the fallacy zoo page I've linked.

I totally destroy religious claims using their own doctrines. No need to bring science into it. Pi not equaling three
is something we know from the science of mathematics, rabbits not eating their cud from biology, and so on. Or did you just mean things like the places the Bible contradicts itself?

*and if you're ever torn apart the Tao te Ching I'd be interested in seeing that. I'm not really sure how to start in regards to finding things it says that are definite enough to object to.

Although, in the case of the Bible, there is at least one scientific observation that's worthy of bringing to bear on the false doctrine.

The doctrine claims that mankind is responsible for bringing imperfection and death into the world. Well, science clearly shows us that death and imprefection existed in the world long before mankind ever came onto the scene.
Well logically you can go earlier than that and say it doesn't make any sense for days to be passing before there was a sun for the Earth to be going around and how it makes even less sense for there to be plants before there were any light sources but most people just sidestep that by saying any time it doesn't make sense you're just reading it wrong.

Well, I've actually seen something pretty similar to that in here...

So the authors of the biblical mythology are caught red-handed in an outright lie.
That's one the church focused a lot of energy working to dispel but nowadays it's more the radicals that deny it while regular folk admit a lot of things are just metaphors rather than actual history telling.

That's a valid use of science to show why a mythology is false.
Nearly ancient thinking though. I like the newer stuff.

But trying to use the argument that science doesn't support intelligent design fails. That's an extremely weak argument that doesn't even hold water anyway.
Saying it's weak doesn't make it so. Tell us how it's weak in regard to the things I've said on that subject, please.

Sky:
Now I feel fairly certain that I have evidence that some other’s don’t have, simply because I have experienced things that some other’s haven’t experienced. So it is a little presumptuous to say that evidence doesn’t exist. The most that can be reasonably said is that one hasn’t seen evidence that one considers acceptable.

Additionally, that reference to “elevating” is a bit vague. As far as I have seen, no one has elevated it to anything beyond “belief”.

So are you objecting to others believing as they choose???
If it's "just what I believe" I don't share it with people. Why do you?
Because I like to understand other people and I assume others like to understand me. And sharing information (e.g. beliefs) is one of the best ways I know of to accomplish that. And of course some people are not interested in understanding me. So in some situations, my assumption proves to be false. But in the main, it works.

Why do you not share your beliefs with others?

Remember reading those sentences where I set up the condition that I don't share my beliefs when people weren't asking? Ya, I don't appreciate having that omitted and then being asked questions I had already well enough answered with it.

I understand I jump around a bit but still.
Or have I mixed up the chronology here?


That’s the surest way I know of to create conflict.

There is no conflict until someone objects.

It is the act of objecting that creates conflict.

Now if your whole purpose is to create conflict, then go ahead and object.

Just don’t forget where the source of any resulting conflict lies.
I generally avoid using this subject in arguments but do you think Jewish people shouldn't have objected to Nazi eugenics practices?
The initial objection was not that of the Jews objecting to eugenics, but the Nazi’s objecting to the Jews. That’s where the downward spiral started. From there it became objections to objections.

But that example is all but irrelevant - unless you’re trying to say that the Jews objecting to Nazi eugenics is comparable to one poster in this forum objecting to the statements of another. :laughing:
By the rules you laid out it would be.

But hey, should Nazis not have objected to Jews ruining their lives? Whether that's what was there or not that's certainly what they thought they saw.

If objection is what creates conflict then conflict is not a meaningful stage of interactions to look at.
I wouldn’t say that. It is meaningful when one is trying to trace back to the root of the conflict.
Don't insult my intelligence, you were just claiming it to be the root.

But pretending for a moment that objecting is the important step people should avoid. This thread was started by someone who has made it clear enough that he thinks there is no evidence of an original intelligent designer. Wouldn't this mean that you are in the wrong for having objected to that?
If I objected to him thinking that, and one considers that objection is “wrong”,
And here you do it again. What in the world did you mean when you were talking about objections earlier?
then yes I would be in the wrong.
But I don’t object to him thinking that. biggrin
But by your own opinions and beliefs you seem to have done something you were criticizing others for. Is this not hypocritical?

Abra:
Abra wrote:

There are other philosophies that allow for this universe to be a cosmic dream by a truely wonderous creator. And everything we see in science just allows for the mechanism of that mind to exist.


Shoku wrote:

What mechanism? What is something we could potentially see that would NOT allow for that?


Well, there you go.

By your own admission science can't rule this out. So why claim that happenstance should be the "default" conclusion? Especially when happenstance doesn't even quality as an explanation in face of what is observed.
Because it doesn't include random extra steps.

If you hear scratching noises at night why is "tree branches on the window" default instead of "demons from hell are trying to claw at the fabric between there and my bedroom and I'd better cover the walls in mustard so they can't get through"? It sounds exactly like either of those things and even if you do find branches scratching on the window you can't wind time back to make sure that's what made the sound the first time, in fact maybe some of the demons already made it out of hell and they positioned the branch there to distract you!


Obviously you're in agreement with me and just don't realize it.
Your methods are awful and I have to dig up explanations for what I thought were common sense in order to talk with you. That you ignore most of them is reason enough by itself to put me at odds with you, but thankfully I am excruciatingly patient.

All I'm saying is that we can't say.
And if some years down the road we look outside of the universe and personally watch the events that lead to it's origin and we can explain all of the reasons the universe is as it is in terms easy enough for everyone to understand then what?

I'm not taking the position that here must be a designer.
And I'm not taking the position that there cannot be, just that evidence does not support it.
But I do hold that when we look at all we know, there is more evidence that points to design than there is that points to happenstance.
What we do have is more philosophical arguments for it than against it but that only indicates how popular either stance is as a belief among those that feel strongly about it.

Perhaps not enough to make any solid conclusions. But certainly enough to recognize that happenstance isn't the obvious answer.
Thus far I see only those questions of yours as the basis that naturalistic origins are not the best answer but that's an argument from ignorance fallacy (and I tore through those like a hot knife through butter anyway.)

That's all I'm saying. That's all I've been saying.

It's wrong to teach people that happenstance should be the default conclusion until we have evidence to the contrary.
It's the default in science. As I have said you are free to believe otherwise. It's important to teach people the default though because otherwise all they learn of what other people think is garbage misrepresentations, like calling any origin without a creator god behind it "chance," "luck," or "happenstance."

That is false. And it's especially false to teach this as 'science' when in fact it's not.
Default doesn't mean "100% certified truth." It means "here's the simplest explanation that fits everything we've seen so far," and you know what? My science teacher were very candid about when we'd seen a lot and when we'd only seen a little or nothing at all. Hopefully other people get the same quality teaching.

We do have evidence to the contary. And that evidence is simply the fact that what we actually see does not imply happenstance.
Try again~

So it's wrong to lead people into the 'belief' that science supports a conclusion of happenstance, when in fact, it doesn't.

That's all I'm saying.
Maybe try paying attention to what I'm saying?



Shoku's photo
Wed 11/04/09 06:18 AM
Actually I was going with primordial Earth just to show how different the life would be with small deviations early on.

The predator strategy might be a bit much since this is supposed to be some of the earliest macroscopic life but nonetheless that's pretty interesting.

Shoku's photo
Wed 11/04/09 06:09 AM

O.K., this is the copy of the email I sent you. (had more time than I thought):wink:

Let's break down the quote in your original post:

The ideal relationship is one where I have someone to not just talk to but with. Sarcasm and not being easily offended are probably the main requirements there.

1.Sounds like you are going to be sarcastic and make fun of her. Women are sensitive. This statement will scare them off. Just say "good sense of humor."
It kind of irks me when people tell me "women are ____." It hits the same switches in my head as "black people waste all their money on gaudy jewelry."

But I'll try and repress that sensation for now.
I can tell the difference between fun and harm. Is "good sense of humor" the only good way to describe that? I had that in a different version of my profile but it didn't seem to help so I got it in my head that maybe it was't descriptive enough.


I'd like someone more excited about the activities available here and will help me get out and do more of it.

2. Sounds like you need someone to force you to get out or hold your hand and show you how to do it. Say something like "lots to do here - need an activity partner."
I'd say remind how :P
But alright, that sounds good.


This one I don't have any idea how I can ask for without ruining the impression of me in the profile but I figure it would work better later in conversation if I could get people to talk with me for awhile. A partner in crime/adventure also works because I know plenty of things that are enjoyable with someone else that enjoys that sort of mischief.

3. Does this mean you do things that are illegal? Mischief sounds a little juvenile.
Hasn't anyone here ever heard of hyperbole? With mischief near it I would think you'd get that I did indeed mean something less severe than crime.
But sure, juvenile probably describes most of it. It's been quite awhile since I had someone else to do that with so everything of the sort was done before I was an adult. I guess I thought there would be more adult versions of the activities but I don't know what they are.

Just say you want someone that enjoys life and isn't a couch potatoe. Use general terms - you will figure each other out, once you have actually met and got to know each other a little. If she is not into the same things as you, then move on.
I might accept this piece but it conflicts with a lot of other people's advice and about the only complements I've had in these threads came from people saying the more descriptive stuff was better.

Anyone have experience with whether the twenty something girls on these sites prefer details or general information?

That does sound like exactly the attitude I tried to make my profile with early on. I've shied away from it thanks to the "whaa, I never get to hold conversations long enough that we learn anything about each other" bellyaching of mine so I think I'll need a little stronger push to flip back to that.


I'm not looking for someone especially clingy. I'm for women's rights and while I don't want to have anything to do with someone who is going to war with anything that is symbolically female I'm not turned on by the idea of having a house slave that lives to dote on me. Moderation is the key here.


4. Too much negativity, even tho it isn't intended that way. Just keep it GENERAL. "I am a very giving person, and am looking for the same."
If this site didn't have a rule against multiple profiles I could just make one of each -_-;


With sex I would probably be easily seduced but I'm looking for a long term relationship and sex there will happen if it happens. So it's not my goal but it's a plus.

5. Again - WAY too much info. Just say "I am NOT looking for a one-night stand." Period. Women will have some respect for that - they don't want any mention of sex, right off the bat.
I got the impression that so many of them only had that in their profiles because of the waves of creeps that message them for that. Not sure why I hadn't considered sticking it in my profile-

That is my best advice for you. Hope it helps.
Ya, after my next bout of exams is over I'm going to have some noticeable revisions to make. Thanks.

Shoku's photo
Wed 11/04/09 05:46 AM
Edited by Shoku on Wed 11/04/09 06:14 AM



I had my two sisters and 1 female friend of mine read alllllllllllllllllll the crap you wrote and it was a victory for,"YOU ARE A BORING,MEAN SPIRITED PERSON AND SHOULD GET A NEW LIFE!!!!tears tears
You see, I asked people to not call me boring and mean spirited and that sort of thing.

It's ok though, I'm going to just not reply to any more posts like this one n_n


What is n_n ??? or T_T ??? I see you use the strange little symbols peppered throughout your posts.
I have evolved beyond the use of yellow smiley faces :O

The underscore is the mouth with those. The n's are an exaggerated curve for when you smile with your eyes closed, and with the T's picture the horizontal line as the eye and the vertical line as a trail of water pouring out of it.



In case that's too hard to see in words.

Or I guess I could pull out bizarre smileys nobody uses



Shoku's photo
Tue 11/03/09 03:16 PM

:JB
**Did I really say that? The designer IS all of the designs? I don't think I did, but that is one way of looking at it.
You didn't say it all at once.
You've said that a butterfly wing is design with the implication that all the patterns of life around us are also design.
You've said that we are continuations of the original creator.
You've said that we are all connected to a universal consciousness that is the designer.

So our bodies are the designs and we are the creator. The creator is the creation.


You may be identifying with YOUR BODY which you are calling THE DESIGN and also THE DESIGNER.

You are assuming the common religious premise. It states that we are our bodies and some God "created" us (our body.) Is this where you are coming from and what you object to?**
Not so much religion. Having a mismatched set of chromosomes produces someone with downs syndrome. Physical trauma to the brain produces people with various other mental impairments. Ever seen the shift in behavior someone has after having had a major stroke?

Whether we are our bodies or a larger entity just expresses itself through them the condition of the bodies drastically affects that expression; it alters our very personality. As such the design and the designer are at least linked sufficiently that the designer is indeed the design.

I said:
If you don't understand or can't make any sense out of what I am trying to say, well, I can understand that.


If I wanted to I could make it make sense to me but I choose not to because I know that the way I would make it work would be different from the way you do it.


**If you are choosing "not to understand" from the very beginning, then what is the purpose of this conversation? **
It's not that I'm choosing to not understand. It's that I am choosing not to force my personality into your understanding.

I do intend to understand it but that requires you to describe a great many things so that I don't assume you meant otherwise. I am very much building up a picture of what you have been saying but there are still some questions about it that I can't answer for you.


**
The hard stuff? Do you then presume that I know all of the answers to "the hard stuff?"
Well I meant the parts that are hard to convey.

I have used this same approach myself on Christians, so I understand the approach. But I do it because they INSIST that they have the truth and everyone else is probably going to hell if they don't submit and agree or "understand." Is that how you view me?
No, you just insist that people who disagree do not understand.

Is this where you are coming from? If so, then I can relate to your position because I have been in that same position with debates with Christians.**

I said:
I say that I 'know' because I feel connected to a living universe. I say that I "don't know" it for a fact because everyone knows that this kind of thing cannot be proven and I am tired of people demanding scientific proof when it cannot be provided.


Only some people are demanding scientific proof. I for one am asking something more like "if I didn't assume any conclusions before I started how could I get to your conclusion in steps?"
With what you've said just now I'd have to "feel it" and that's the only step.


**
But you DO and already HAVE assumed all of your conclusions and you have made the choice "not to understand" the reasons for my conclusions. I have many reasons and I could not possibly convey all of them to you.
You'll convey enough if I don't frustrate you so much that you leave. If you'd like to speed it up you can tell me about the most varied reasons so I can fill out the range of the spectrum your reasons lie on. I've had a lot of exposure to people on both sides of these kinds of topics so there's a pretty small chance that you'll have many reasons I haven't heard before, I just need to work out which ones (and if you do have anything I haven't seen before that would be neat too.)

You would have to live my life, and experience everything I have experienced and learn everything I have learned. I'm not sure if I am ready to write an auto-biography, nor do I have the time to do this at this time in this post.**
Well we can continue with my "here's something reasonably objective I've picked up in my experiences that seems to pose a problem for that reason" format and see if you can throw me any stumpers. It won't very likely change your mind but if you're a genuinely honest person and you can't defend a reason against that you won't be able to call it "a problem" to anyone else's face and with the objective tone I aim for in describing processes maybe you'll even find something useful to share with other people, if only to show that you understand biology.


The trouble I have with that is that people feel different things. I'd even bet there are some people in here who "feel" that the thing you feel is all in your head.
So what makes yours better than theirs?


**I don't know if mine is 'better' than theirs. (I am not them.) I also don't know what 'theirs' is or why. That is why I engage in this kind of conversation. To learn more and understand more about their beliefs. My beliefs and conclusions are all I have at this point. I share them so people can know where I am.**
That would be your opinion and opinions aren't right or wrong so you would be safe from criticism but the problem is that this thread was asking about evidence. Evidence isn't an opinion- it is objective.

You opinion isn't any worse than any other without evidence. It's fine to just believe but sharing it when other people didn't ask is, well, preaching.
You understand why people wouldn't be very welcoming of someone preaching to them when they were asking for arguments, right?

*If you thought that what each person feels should be their own guide it wouldn't make any sense for you to have been sharing what you feel- it would be nothing but static taking up space for the rest of us.


**I only speak for myself when it comes to feeling your way to the truth. I am not trying to tell anyone else how to do it. Each person will find their own way. I share what I feel and believe so that you may know where I am.**
And I give reasons so that people can decide if they agree or do not on something beyond the limit of their own experiences. I don't run into a lot of people that disagree after having taken up that offer but I don't run into many of them who stick around long enough to learn that I was doing that instead of sharing my opinion as they were sharing theirs.

I said:
This age old and worn out argument about spirituality and 'God' is just getting boring and tiresome. If a person doesn't want to speculate about the possibilities then why even get involved in the conversation in the first place?


Well for me there's the issue of politics. Unfortunately I know about an alarming number of cases where people didn't say anything against spirituality and then the spirit minded people used that silence to mandate their beliefs into law.

After that people realize what just happened and start fussing about it again and pretty quickly they get it taken back out of law but still, it screws up a grade or two of children when it's educational but even if it's not it is always unjust.



It sounds like you are talking about religion and politics here and that you are fighting that battle.
I'm just giving it some visibility among people not aligned against it so much as myself. It is the reason I look for these topics but because you aren't a young Earth creationist of the fundamentalist variety (I think that is probably redundant,) I've stayed for other reasons.

Good for you, keep up the good work. But don't mistake me for a politician or a religious fanatic just because I see things from a spiritual point of view.

Thin about it this way: If someone asks "why can't we just take what we want? I know how to consider others and moderate myself." you basically say "sure but there are people out there that don't."
That's all I was saying there.

Dragoness:
But of course you hold that position it is your position without any evidence of any kind.

I removed from your post all of the non proof you included with exception of this list of questions which the answers prove the opposite of what you imply they do.

Of course there is a similarity at a molecular level in the universe. I wouldn't be surprised to find that at a smaller than atomic level we are almost exactly the same composition. That makes sense for a natural event.

Abra, you claim all this scientific knowledge and yet you do not take scientific view to this subject. You are clouded by your desire that there be a designer.
He's heard about science but he hasn't learned or been involved with it.

Or at the very least he sure as hell wasn't a chemistry or physics teacher.

Shoku's photo
Tue 11/03/09 01:47 PM
Abra:
For whatever it's worth, I too at vehemently against certain religions. Especially the ones that claim to have books that contain the commandments, threats, and directives, of jealous gods that lust to be the King of Kings and Lord of Lords over all humanity.

Those kinds of dogmatic religions that claim to be the word of God should indeed be outlawed as "hate crimes" and there is a "Burden of Proof" invovled there. After all the claim is that a book is the word of God, then there should be a "Burden of Proof" to prove that claim.
So burden of proof on "this book is the book of God" but not burden of proof on "this dirt is the dirt of God"?


However, just because what you say about some religions if quite true, is no reason to take that over into science and use it as an excuse to claim that science supports ahtheism.
I thought I already said this :P

That's just an over-reaction that doesn't do anyone any good.

If we're going to seek truth we need to keep an open mind and not allow hateful dogmatic religions to fill us with fear, anger, and resentment toward the very idea of an potential cosmic or supernatural intelligence.
Again, I'm not against the idea, it just only works as a baseless belief. We keep the default at it's simplest while still explaining everything we have observed so if anyone wants to believe something they can insert it into the default. If you switch from the "against God" definition of atheism to the "without God" definition then sure it's atheistic but that just gives everyone a chance to think whatever they want, aside from when it clearly conflicts with those things we've seen.
The lines between some of these things get a bit fuzzy at times but I hope you get the gist of it.

The recognition that an intelligence may have been responsible for creating this universe does not automatically loan credence to mythologies that have jealous angry gods that instruct people to provide them with blood sacrifices for repentance. Such gods can hardly be called "intelligent" anyway.

That's awfully closed minded. Maybe they just seem unintelligent because you've already accepts all the little ifs a certain way that makes them so. Maybe there are damn good reasons for blood sacrifices that you just won't accept as possibilities.

...you don't need to agree with that but I hope you see the similarity between it and what you've said.

So if there is an intelligent creator of the universe that would automatically rule out all those utterly stupid religions with blood-thirsty gods who solve all their problems using hostile bloody violent means.
What problems exactly did blood sacrifices solve for those gods?

There's nothing intelligent about that! sick
So in other words you are saying it's wrong because it's ridiculous? I really don't like those religions either and I'm certainly not saying they are right but your arguments before them are grossly flawed. I hope that is only due to you not being thorough because you didn't think anyone here would disagree and not because you're incapable of forming a real argument against that.

We can't allow religions to be the guiding factor in our intellectual pursuit of truth.
So what other guiding factor(s) has lead you to "design"?

If the evidence for design exist, we must pursue it in spite of the fact that the people who worship horrid religions will try to use that information to bolster their hateful mythological dogmas.
Alright, point me at some evidence to pursue if you can.

Shoku's photo
Tue 11/03/09 12:11 PM
Edited by Shoku on Tue 11/03/09 12:12 PM
Abra:
There's no such thing as a legitimate "conjecture" of a "non-explanation". If you don't have an explanation then you don't have a conjecture. To even call that a "conjecture" is a total abuse of the concept.
Basically yes, and that's why "there isn't _____" can't shoulder the burden of proof.

Moreover, your example of an "invisible anything" is a bogus example, and quite misleading. Something that has no observable qualities requires no explanation at all. To even talk about such a thing would be a farce.
I quite agree. Do you think the designer of our universe has any observable qualities?

However, the universe is the object in question and it's hardly 'invisible', it has plenty of observables that need to be explained.
Does the explanation get to be "an invisible unicorn did it" or do we need to observe some indication of it before we can claim it as the cause of things?

Going back to the previous quote above, "happenstance" does not explain the observables that we see.
Ya, happenstance is a f___ing mongoloid explanation for things. Only an brain dead idiot would say it was happenstance.

Luckily the naturalistic explanation is nearly as different from happenstance as the designer explanation.

I realize that you're about to claim that happenstance (or "random naturalism" as you call it)
NO. NOT random.

does work in your next quote, but I'll show why that's a total fallacy as well.

-

I fully understand all of those processes. I fully understand the theory of evolution and I don't argue with it one iota. Don't kid yourself.
Describe it then.

You're missing the point.
I fully understand the point and I don't agree with it one iota. Don't kid yourself.

We're talking about the creation of the universe here. Not processes that the going on within universe after it had been created. The question is whether or not the universe is by design or random chance.
Scarecrow argument. I might as well say the questions is whether the universe is by ghost elves in the spiritual north pole or naturalism. It wouldn't be any further off than what you keep insisting, though since it makes the other side sound stupid I'm sure you'll react much stronger to it.

What I'm saying is that this universe itself was designed to evolve into complex living things.

You can't take the Miller Urey experiment and say, "See! If we take 'dirt' from this universe and we set it up in the proper conditions it will 'automatically' form amino acids, which can then can go on to form DNA, which can then go on to program itself to create living beings, etc."
*"Program itself" might have some problems depending on how you define life.

Even the Christians have a comeback for that silly argument: "If you're going to create life by happenstance start with you own dirt! Don't be using God's dirt!" laugh
*If you've heard much about LHC you'll have heard that we might actually start doing that. We're not certain that that stuff works in a way that that will happen but it's a possibility.

If an intelligent designer designed this universe that entity designed it before the big bang. And it was indeed designed to unfold in ways that now appear to be 'happenstance' (or natural processes) within this universe.
I still don't get why you think natural processes are interchangeable with coincidence.

You seem to be entirely missing my argument here. You're looking at the question form a point of view after the fact. You're looking at processes that are occurring within the universe way beyond the moment of creation.
You're right but that's mainly because I've been trying to teach JB about genetics.

If you want to exam the question of whether or not this universe is happenstance or design you need to look at the moment of creation (or even before that if possible).
Working on it but it's esoteric work so average people don't ever hear about it in a way that they can understand why anyone bothers.

You need to ask the following questions:

Why are there only 100 differnet kinds of elements in this universe?
Basic chemistry will tell you about that. The try and sum it up quickly because of strong and weak nuclear forces.

Your question is flawed though as there are not only 100 types. Any combination of protons and neutrons can exist but most of them are very radioactive and shoot off parts or split them until they get to the more stable ones we are familiar with (but even those eventually undergo radioactive decay, just on much longer timescales.)

At the smallest elements you only need maybe one neutron but as you move up soon there's so much positive charge all clustered up that you need more neutrons to glue it together so you need two per proton and then three and eventually you get to where there aren't enough places to grab on to to hold things together.

http://www.ptable.com/
If you look closely you'll notice that the "natural" elements only go up to 92 anyway. The rest we made in labs and only had tiny tiny fractions of seconds to figure out how they behave and such before they decayed.

Particle physics is one of those points where I reach the limits of things I know well enough to describe to normal folk but if you want to know more detail about why different isotypes of elements are more stable than others that is what you will have to educate yourself about.

Why do those extremely few atoms just happen to be in the abundances they are?

If you were familiar with big bang instead of that watered down version they start teaching kids in first grade you'd-
well, I'll just try to describe it a bit (but I admit I'm leaving out some important things to keep it from getting much much longer than this.)

Picture that moment after the very start. There was a whole lot of energy uniformly spread everywhere in the universe but things were very compact then so you had so much energy at any particular point that it was just too hot for atoms.

-but as the whole universe stretched there was more room and less dense energy means lower temperatures so in a fashion a little bit like raindrops forming from a cloud of water vapor you had protons, electrons, and neutrons form from a cooling cloud of energy. As I'm sure you know when you put these together they form atoms. One proton can grab one electron (sometimes more or less but it easily gives them away or grabs another one,) so with just one proton you get hydrogen. Things were still pretty hot though so about one in four atoms had two protons stuck together and those are hydrogen. A small number even had three which means lithium but with the temperatures changing the way they did that's as high as things went from this particular trend.

So what about all the others? Well, with enough energy you can fuse these atoms together and if it's a more stable it will even give off more energy that can fuse others and so on.
And where do we find high temperatures after the background cooled off? Well obviously those funky spots where gravity pulled a lot of those gasses together into one of those big balls we call stars.

It's easiest to fuse hydrogen but helium is heavier so after long enough it moves to the middle (down) and takes up all the hottest areas. If the star was big enough it will eventually push down with enough pressure that it will be hot enough to fuse helium. Next element builds up and so on until iron. Iron is a bit tricky as it has the lowest energy configuration- it just sucks up even more heat to be fused without giving any off. This means this whole "star" trend ends at that element.

But there's a way to get enough energy to keep going. If a star is really freaking huge and gets to the iron point of fusion there's something else that can happen. Heat is the main thing that pushes out from inside of a star but because iron just keeps sucking it up pretty soon you've only got gravity pushing things down. With small stars they hold their weight but the big ones are so heavy that the forces of the atoms themselves can't hold it up and the star collapses in on itself until things are so compact that everything turns into neutrons. It turns out at that heat it's actually smaller than the space neutrons take up and they have enough force to hold everything up so it bounces back to a bigger shape and there is so much energy involved in that that we see the star explode as a supernova. These explosions give us all of the elements up to tricky 92.
*Realistically I'd expect a lot of them make heavier stuff but since those elements decay so quickly and already take the most energy to make meaning there are fewer of those atoms anyway they all decay really quickly and we just see 1 through 92.

Why do they naturally form molecules that automatically become self-programming?
Miller Urey experiment gets you halfway through that question. To get through the other half you need amino acid chains and RNA chains. These two molecules are able to make duplicates of other such chains- that's not very good though because that's like having no babies while everyone else has lots and you know that's no good at higher scales thanks to that well known survival of the fittest idea.
But if you stick them inside of a bubble they can find a copy of themselves much more easily so inside of a bubble it's like they make lots of babies while others don't make so many.

Right here is an easy piece of evidence to understand: guess what the wall between the inside and outside of cells is? A bubble.
No, I don't mean it just looks like a bubble, I mean it's actually made out of bubble molecules. This is a big part of why just drying off a counter top will kill 99.9% of the microorganisms on it- if you touch a bubble with a wet finger your finger goes in and it stretches over your finger no problem but try that with a dry finger and you rip the layer of water away from it and the bubble molecules go from a wall to more of a powder without a layer (or more) of water sitting on them and a powder can't hold that shape together so it pops.

Well turns out proteins can help to make those bubbles a little bit resistant to water loss so it's good to have them. Chains that make copies of themselves, a membrane, and a reason to make copies of things to keep the membrane around- sounds like all you need for some selection doesn't it?

Obviously more to this story just like big bang elements stuff but that's the general idea and judging by the questions you're asking no, you didn't know about that and I'm not kidding myself explaining it.

Why is that digital information driven to form complex living being with brains?
Why did they come together so quickly on this planet after it had cooled?
Brains took billions of years bucko. That's not quick at all.
And no, I'm not just talking about our brains. It took microscopic life 3 billion years to evolve to the point where they worked out a good enough energy reaction to turn into big complex things like us and you had little more than pond scum before that.

If that was truly a happenstance event then why did it occur in such a timely fashion on planet Earth? Life began to unfold almost immediately, as soon as conditions were ripe on Earth. And you call that happenstance?
FOR F_CK SAKE NO. I don't call that happenstance. I don't call that random. I call that naturalistic. A naturalistic process happens for a reason and with such defined interactions between things it can happen quickly. Of course we didn't just up and randomly get life on Earth for no reason, much less in a rapid fashion.

No wait! You call it a 'natural process'.
Oh good, you were just mocking me. I thought you were dense for a minute there.

But what does that mean? Natural with respect to what? Natural with respect to the construction and content of this universe.
Close enough.

But that's what's in question here. Was this universe designed to do this? Or did this universe just come into being by happenstance.
Check out string theory if you want to know about that. I think I've typed enough long explanations for one post.
That is the question being asked here. Not whether we can explain evolution in terms of being a 'natural process within this universe'. Clearly it is. That's a given.
Look at the other people advocating design in here and you'll see people who don't think so.

The real question is why does this universe have that nature?
Why does making more copies of yourself than others eventually make you into a majority? This is a hard question to approach because you are basically asking why is five more than three.

Do you think five being more than three is evidence that our universe was designed?

1 2 … 9 10 11 13 15 16 17 … 20 21